Mutagenetix > Incidental Mutations

Incidental Mutation 'R5445:Rrm1'

427403

Institutional Source

Beutler Lab

Gene Symbol

Rrm1

Ensembl Gene

ENSMUSG00000030978

Gene Name

ribonucleotide reductase M1

Synonyms

RnrM1

MMRRC Submission

043010-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R5445 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102441695-102469771 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102451023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 204 (T204S)

Ref Sequence

ENSEMBL: ENSMUSP00000033283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033283] [ENSMUST00000211720]

AlphaFold

P07742

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033283
AA Change: T204S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: T204S

Domain	Start	End	E-Value	Type
Pfam:ATP-cone	1	89	8.7e-21	PFAM
Pfam:Ribonuc_red_lgN	141	213	2.8e-25	PFAM
Pfam:Ribonuc_red_lgC	216	738	1.6e-197	PFAM
coiled coil region	749	778	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210751

Predicted Effect

probably benign
Transcript: ENSMUST00000211720

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430105I19Rik	T	C	2: 118,759,586	D259G	probably damaging	Het
Abcg5	A	T	17: 84,671,129	D300E	probably damaging	Het
Apbb1ip	T	C	2: 22,835,948	V244A	possibly damaging	Het
Arhgap32	T	C	9: 32,248,382	S232P	probably benign	Het
Atf7ip	G	A	6: 136,587,257	V833M	probably damaging	Het
Casp7	A	G	19: 56,433,338		probably null	Het
Celsr2	T	A	3: 108,392,658	E2911D	probably benign	Het
Cep350	T	C	1: 155,894,723	D1807G	probably benign	Het
Chrd	A	G	16: 20,738,910	T753A	possibly damaging	Het
Clasp2	A	G	9: 113,903,946	D971G	probably damaging	Het
Cnnm2	A	G	19: 46,877,288	T772A	possibly damaging	Het
Cntn1	A	T	15: 92,295,077	N687Y	probably damaging	Het
Col6a3	G	A	1: 90,782,039	R1812*	probably null	Het
Dsc2	T	C	18: 20,035,303	I700V	possibly damaging	Het
Fam71d	G	A	12: 78,715,116	E185K	probably damaging	Het
Flt3	G	A	5: 147,355,095	Q540*	probably null	Het
Fmo4	T	A	1: 162,805,273	I170F	probably benign	Het
Fra10ac1	T	A	19: 38,219,462	D72V	possibly damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Gm13023	T	A	4: 143,795,137	V441E	possibly damaging	Het
Gm2381	T	G	7: 42,820,001	H233P	probably damaging	Het
Gm5148	T	A	3: 37,714,846	Q75L	probably damaging	Het
Gm8369	T	C	19: 11,504,806	V27A	possibly damaging	Het
Gpr157	T	C	4: 150,102,368	S318P	probably benign	Het
Hectd4	G	A	5: 121,266,274	V405M	probably benign	Het
Hemgn	T	C	4: 46,400,738	R41G	probably benign	Het
Hhipl1	T	A	12: 108,328,208	L791Q	probably damaging	Het
Hjurp	T	G	1: 88,266,316	K290T	probably benign	Het
Ifi207	T	C	1: 173,727,797	E773G	probably damaging	Het
Kcnh6	T	C	11: 106,023,859	Y697H	probably damaging	Het
Lonrf2	T	C	1: 38,807,153	T313A	probably benign	Het
Lrba	G	T	3: 86,368,595	V1757L	probably benign	Het
Lrrc24	T	C	15: 76,716,106	T278A	probably benign	Het
Ltbp2	T	C	12: 84,809,654	I679V	probably null	Het
Mapk4	G	T	18: 73,931,002	T383K	probably benign	Het
Mdn1	C	T	4: 32,723,690	P2542L	probably damaging	Het
Mia3	A	G	1: 183,336,022	V208A	probably benign	Het
Myo15	C	A	11: 60,520,777	C3234*	probably null	Het
Nlrp1b	G	T	11: 71,217,875	Q267K	probably benign	Het
Nphp3	A	G	9: 104,004,723	K37E	probably damaging	Het
Nwd2	T	C	5: 63,805,338	M755T	probably damaging	Het
Olfr482	A	G	7: 108,094,742	V276A	possibly damaging	Het
Olfr655	A	G	7: 104,596,821	F120S	probably damaging	Het
Olfr819	T	A	10: 129,966,289	H137L	probably benign	Het
Pdlim5	C	T	3: 142,352,734	R83K	probably null	Het
Plekha5	A	T	6: 140,552,733	R173*	probably null	Het
Rbms3	T	A	9: 117,251,785	D6V	possibly damaging	Het
Rhoq	A	T	17: 86,964,327	Y57F	probably benign	Het
Slf1	A	T	13: 77,091,204	I447N	probably benign	Het
Smarcc2	T	A	10: 128,488,074		probably benign	Het
Spdye4c	C	T	2: 128,596,564	Q281*	probably null	Het
Tert	T	A	13: 73,644,284	M890K	probably benign	Het
Tln1	C	A	4: 43,543,905	R1198L	probably benign	Het
Tmco4	A	G	4: 139,020,867	M253V	probably damaging	Het
Usp19	G	T	9: 108,497,920	V782F	possibly damaging	Het
Usp33	T	A	3: 152,374,623	S464T	probably damaging	Het
Usp47	A	T	7: 112,074,721	Y397F	probably damaging	Het
Vmn1r12	A	G	6: 57,159,481	T144A	probably benign	Het
Vmn2r90	A	T	17: 17,734,124	H850L	probably benign	Het
Wdr66	C	T	5: 123,287,177	T294M	probably damaging	Het
Zfhx3	A	T	8: 108,956,210	Q3427L	unknown	Het
Zfp236	G	T	18: 82,682,156	Q63K	probably benign	Het
Zfp7	T	A	15: 76,890,854	C365*	probably null	Het
Zfp786	T	C	6: 47,819,685	E773G	probably damaging	Het

Other mutations in Rrm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rrm1	APN	7	102454507	nonsense	probably null
IGL01431:Rrm1	APN	7	102457552	splice site	probably benign
IGL03251:Rrm1	APN	7	102457206	missense	probably damaging	1.00
IGL03401:Rrm1	APN	7	102465744	missense	possibly damaging	0.81
Arabica	UTSW	7	102460351	missense	probably damaging	1.00
Pentose	UTSW	7	102460856	splice site	probably null
R0454:Rrm1	UTSW	7	102466926	missense	probably damaging	1.00
R0548:Rrm1	UTSW	7	102467067	critical splice donor site	probably null
R0759:Rrm1	UTSW	7	102457561	missense	probably benign	0.32
R1575:Rrm1	UTSW	7	102456514	missense	probably damaging	1.00
R1586:Rrm1	UTSW	7	102466905	makesense	probably null
R1625:Rrm1	UTSW	7	102468347	missense	probably damaging	0.98
R2207:Rrm1	UTSW	7	102442026	start codon destroyed	probably null	0.98
R2432:Rrm1	UTSW	7	102443072	missense	probably benign	0.03
R2513:Rrm1	UTSW	7	102460689	missense	probably damaging	0.99
R3796:Rrm1	UTSW	7	102465703	splice site	probably null
R3914:Rrm1	UTSW	7	102457174	missense	probably damaging	1.00
R4179:Rrm1	UTSW	7	102457198	missense	probably damaging	1.00
R4302:Rrm1	UTSW	7	102447824	missense	probably benign	0.00
R4379:Rrm1	UTSW	7	102446593	missense	probably damaging	1.00
R4416:Rrm1	UTSW	7	102447801	missense	probably benign	0.06
R4690:Rrm1	UTSW	7	102447879	missense	probably benign
R4939:Rrm1	UTSW	7	102466924	missense	probably benign	0.34
R5433:Rrm1	UTSW	7	102465767	missense	probably damaging	0.97
R6120:Rrm1	UTSW	7	102460856	splice site	probably null
R6198:Rrm1	UTSW	7	102446729	critical splice donor site	probably null
R6369:Rrm1	UTSW	7	102446702	missense	probably damaging	0.97
R6699:Rrm1	UTSW	7	102460825	missense	probably damaging	1.00
R7009:Rrm1	UTSW	7	102460334	missense	probably damaging	1.00
R7491:Rrm1	UTSW	7	102454557	missense	probably damaging	1.00
R8024:Rrm1	UTSW	7	102457265	missense	probably benign	0.00
R8276:Rrm1	UTSW	7	102460852	critical splice donor site	probably null
R8713:Rrm1	UTSW	7	102460351	missense	probably damaging	1.00
R8963:Rrm1	UTSW	7	102456532	missense	probably benign	0.23
R8968:Rrm1	UTSW	7	102468338	missense	probably benign	0.03
R9028:Rrm1	UTSW	7	102460398	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTCAGATGTGTTTCAGACTAATT -3'
(R):5'- TGTGATGAACCACCTGGCTTT -3'

Sequencing Primer
(F):5'- CTGTGGGGATTCACAAAG -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'

Posted On

2016-09-01