Incidental Mutation 'R5445:Usp19'
ID427410
Institutional Source Beutler Lab
Gene Symbol Usp19
Ensembl Gene ENSMUSG00000006676
Gene Nameubiquitin specific peptidase 19
Synonyms8430421I07Rik
MMRRC Submission 043010-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.503) question?
Stock #R5445 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108490602-108502337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108497920 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 782 (V782F)
Ref Sequence ENSEMBL: ENSMUSP00000141738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]
Predicted Effect probably benign
Transcript: ENSMUST00000006854
AA Change: V783F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676
AA Change: V783F

DomainStartEndE-ValueType
Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085044
AA Change: V783F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676
AA Change: V783F

DomainStartEndE-ValueType
Pfam:CS 55 129 4.7e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 2.5e-15 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 524 530 N/A INTRINSIC
Pfam:UCH 538 1253 7.4e-84 PFAM
Pfam:UCH_1 539 879 2.3e-13 PFAM
Pfam:zf-MYND 833 875 2.4e-10 PFAM
Pfam:UCH_1 1020 1235 2.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166103
AA Change: V759F

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676
AA Change: V759F

DomainStartEndE-ValueType
Pfam:CS 55 129 2.6e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 390 3.9e-9 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 500 506 N/A INTRINSIC
Pfam:UCH 514 1229 1.8e-84 PFAM
Pfam:UCH_1 515 855 5.5e-14 PFAM
Pfam:zf-MYND 809 851 1.7e-10 PFAM
Pfam:UCH_1 996 1211 6.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178075
AA Change: V784F

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676
AA Change: V784F

DomainStartEndE-ValueType
Pfam:CS 55 129 1e-6 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 5.4e-15 PFAM
low complexity region 450 461 N/A INTRINSIC
low complexity region 525 531 N/A INTRINSIC
Pfam:UCH 539 1254 4.9e-84 PFAM
Pfam:UCH_1 540 880 1.4e-13 PFAM
Pfam:zf-MYND 834 876 5.2e-10 PFAM
Pfam:UCH_1 1021 1236 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193412
Predicted Effect probably benign
Transcript: ENSMUST00000193558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193571
Predicted Effect possibly damaging
Transcript: ENSMUST00000193678
AA Change: V782F

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676
AA Change: V782F

DomainStartEndE-ValueType
Pfam:CS 55 129 6.8e-7 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 3.6e-15 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 523 529 N/A INTRINSIC
Pfam:UCH 537 1252 3.8e-84 PFAM
Pfam:UCH_1 538 878 1.1e-13 PFAM
Pfam:zf-MYND 832 874 5.1e-10 PFAM
Pfam:UCH_1 1019 1234 1.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193975
Predicted Effect unknown
Transcript: ENSMUST00000194171
AA Change: V413F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194499
Predicted Effect unknown
Transcript: ENSMUST00000194863
AA Change: V35F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195763
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased body weight, reduced male fertility, and increased resistance to skeletal muscle atrophy induced by both glucocorticoids and denervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Abcg5 A T 17: 84,671,129 D300E probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Casp7 A G 19: 56,433,338 probably null Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Cep350 T C 1: 155,894,723 D1807G probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Cntn1 A T 15: 92,295,077 N687Y probably damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Fra10ac1 T A 19: 38,219,462 D72V possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Kcnh6 T C 11: 106,023,859 Y697H probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mia3 A G 1: 183,336,022 V208A probably benign Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Pdlim5 C T 3: 142,352,734 R83K probably null Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Spdye4c C T 2: 128,596,564 Q281* probably null Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp33 T A 3: 152,374,623 S464T probably damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Zfp786 T C 6: 47,819,685 E773G probably damaging Het
Other mutations in Usp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Usp19 APN 9 108498961 missense possibly damaging 0.79
IGL02345:Usp19 APN 9 108493858 missense probably benign
IGL03026:Usp19 APN 9 108493145 missense probably damaging 1.00
IGL03057:Usp19 APN 9 108499130 missense probably benign 0.01
IGL03073:Usp19 APN 9 108495803 unclassified probably benign
IGL03333:Usp19 APN 9 108494149 missense probably benign 0.05
PIT4504001:Usp19 UTSW 9 108492970 missense probably benign 0.00
PIT4576001:Usp19 UTSW 9 108492732 critical splice donor site probably null
R0053:Usp19 UTSW 9 108497170 splice site probably null
R0053:Usp19 UTSW 9 108497170 splice site probably null
R0138:Usp19 UTSW 9 108501315 missense possibly damaging 0.86
R0281:Usp19 UTSW 9 108498509 missense probably damaging 1.00
R0386:Usp19 UTSW 9 108499711 missense probably damaging 1.00
R0454:Usp19 UTSW 9 108494240 critical splice donor site probably null
R0506:Usp19 UTSW 9 108494487 missense probably damaging 1.00
R0542:Usp19 UTSW 9 108494385 unclassified probably null
R0800:Usp19 UTSW 9 108495154 missense probably damaging 0.97
R0829:Usp19 UTSW 9 108493801 missense probably benign
R1594:Usp19 UTSW 9 108498522 missense probably damaging 1.00
R1917:Usp19 UTSW 9 108499325 nonsense probably null
R3744:Usp19 UTSW 9 108500181 missense probably damaging 1.00
R3964:Usp19 UTSW 9 108498029 missense probably damaging 1.00
R4275:Usp19 UTSW 9 108498694 missense probably damaging 1.00
R4789:Usp19 UTSW 9 108493234 missense possibly damaging 0.75
R5247:Usp19 UTSW 9 108496065 splice site probably null
R5249:Usp19 UTSW 9 108492608 start codon destroyed probably null 0.85
R5400:Usp19 UTSW 9 108500193 missense probably damaging 1.00
R5578:Usp19 UTSW 9 108493440 missense probably benign
R5934:Usp19 UTSW 9 108492567 unclassified probably benign
R6003:Usp19 UTSW 9 108496380 missense probably damaging 1.00
R6217:Usp19 UTSW 9 108500144 missense probably damaging 1.00
R6230:Usp19 UTSW 9 108501941 missense probably damaging 0.99
R6505:Usp19 UTSW 9 108496883 missense probably damaging 1.00
R6585:Usp19 UTSW 9 108499727 missense probably damaging 0.97
R6865:Usp19 UTSW 9 108498819 nonsense probably null
R6953:Usp19 UTSW 9 108498931 missense possibly damaging 0.90
R7037:Usp19 UTSW 9 108496958 missense possibly damaging 0.52
R7046:Usp19 UTSW 9 108497135 missense possibly damaging 0.48
R7235:Usp19 UTSW 9 108494924 nonsense probably null
R7705:Usp19 UTSW 9 108501913 missense possibly damaging 0.89
RF041:Usp19 UTSW 9 108493988 critical splice acceptor site unknown
Predicted Primers PCR Primer
(F):5'- GGGCAAGCATATTCCTCTTTTAGTC -3'
(R):5'- GCACTTGGAGATAGGGATGC -3'

Sequencing Primer
(F):5'- AGTCCACATATCATGTCCTGC -3'
(R):5'- TGGGTCATCTGGCTCAGCAAG -3'
Posted On2016-09-01