Incidental Mutation 'R5445:Kcnh6'
ID427418
Institutional Source Beutler Lab
Gene Symbol Kcnh6
Ensembl Gene ENSMUSG00000001901
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 6
Synonymsm-erg2
MMRRC Submission 043010-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5445 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106008124-106034549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106023859 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 697 (Y697H)
Ref Sequence ENSEMBL: ENSMUSP00000001965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001965] [ENSMUST00000106903] [ENSMUST00000145539]
Predicted Effect probably damaging
Transcript: ENSMUST00000001965
AA Change: Y697H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001965
Gene: ENSMUSG00000001901
AA Change: Y697H

DomainStartEndE-ValueType
Blast:PAS 13 87 2e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
Pfam:Ion_trans 256 523 6.8e-40 PFAM
Pfam:Ion_trans_2 445 517 2.6e-13 PFAM
cNMP 594 712 3.21e-23 SMART
coiled coil region 782 809 N/A INTRINSIC
low complexity region 901 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106903
AA Change: Y644H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102516
Gene: ENSMUSG00000001901
AA Change: Y644H

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
Pfam:Ion_trans 302 420 6.2e-10 PFAM
Pfam:Ion_trans_2 395 464 2.6e-9 PFAM
cNMP 541 659 3.21e-23 SMART
coiled coil region 729 756 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145539
AA Change: Y697H

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137675
Gene: ENSMUSG00000001901
AA Change: Y697H

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
Pfam:Ion_trans 302 511 1.4e-22 PFAM
Pfam:Ion_trans_2 442 517 2e-13 PFAM
cNMP 594 712 3.21e-23 SMART
low complexity region 764 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Abcg5 A T 17: 84,671,129 D300E probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Casp7 A G 19: 56,433,338 probably null Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Cep350 T C 1: 155,894,723 D1807G probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Cntn1 A T 15: 92,295,077 N687Y probably damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Fra10ac1 T A 19: 38,219,462 D72V possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mia3 A G 1: 183,336,022 V208A probably benign Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Pdlim5 C T 3: 142,352,734 R83K probably null Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Spdye4c C T 2: 128,596,564 Q281* probably null Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp19 G T 9: 108,497,920 V782F possibly damaging Het
Usp33 T A 3: 152,374,623 S464T probably damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Zfp786 T C 6: 47,819,685 E773G probably damaging Het
Other mutations in Kcnh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Kcnh6 APN 11 106019019 missense probably damaging 1.00
IGL01349:Kcnh6 APN 11 106023917 missense possibly damaging 0.82
IGL01529:Kcnh6 APN 11 106020696 missense probably benign 0.07
IGL01555:Kcnh6 APN 11 106017619 missense probably damaging 0.99
IGL01596:Kcnh6 APN 11 106026746 missense probably benign 0.02
IGL01808:Kcnh6 APN 11 106023927 splice site probably benign
IGL02001:Kcnh6 APN 11 106027549 splice site probably benign
IGL02131:Kcnh6 APN 11 106020175 missense probably damaging 1.00
IGL02254:Kcnh6 APN 11 106020707 missense probably damaging 1.00
IGL02413:Kcnh6 APN 11 106027634 missense possibly damaging 0.77
R0089:Kcnh6 UTSW 11 106009022 missense probably benign 0.31
R1914:Kcnh6 UTSW 11 106017444 nonsense probably null
R1915:Kcnh6 UTSW 11 106017444 nonsense probably null
R2265:Kcnh6 UTSW 11 106033817 missense probably benign
R2325:Kcnh6 UTSW 11 106033835 missense probably benign 0.00
R4449:Kcnh6 UTSW 11 106018936 missense probably damaging 0.99
R4548:Kcnh6 UTSW 11 106009049 missense probably damaging 1.00
R5095:Kcnh6 UTSW 11 106017254 missense possibly damaging 0.92
R5166:Kcnh6 UTSW 11 106020319 missense possibly damaging 0.67
R5358:Kcnh6 UTSW 11 106027591 missense possibly damaging 0.93
R5652:Kcnh6 UTSW 11 106008985 missense probably damaging 1.00
R5708:Kcnh6 UTSW 11 106020256 missense probably benign 0.04
R5742:Kcnh6 UTSW 11 106009142 missense probably benign 0.32
R6035:Kcnh6 UTSW 11 106019152 critical splice donor site probably null
R6035:Kcnh6 UTSW 11 106019152 critical splice donor site probably null
R6150:Kcnh6 UTSW 11 106020731 missense possibly damaging 0.83
R6827:Kcnh6 UTSW 11 106009099 missense probably benign 0.05
R7172:Kcnh6 UTSW 11 106020274 missense possibly damaging 0.86
R7329:Kcnh6 UTSW 11 106017377 missense probably benign 0.29
R7359:Kcnh6 UTSW 11 106018963 missense possibly damaging 0.46
R7542:Kcnh6 UTSW 11 106014561 missense possibly damaging 0.68
R7571:Kcnh6 UTSW 11 106017416 missense probably benign 0.01
R7580:Kcnh6 UTSW 11 106017548 missense probably damaging 1.00
R7703:Kcnh6 UTSW 11 106023877 missense probably benign
R7726:Kcnh6 UTSW 11 106017575 missense probably benign 0.04
R7837:Kcnh6 UTSW 11 106033810 missense probably benign 0.04
R7854:Kcnh6 UTSW 11 106017346 missense probably damaging 1.00
R7920:Kcnh6 UTSW 11 106033810 missense probably benign 0.04
R7937:Kcnh6 UTSW 11 106017346 missense probably damaging 1.00
X0065:Kcnh6 UTSW 11 106025795 missense probably benign
Z1088:Kcnh6 UTSW 11 106009048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATCACAGTCAATGGGGCC -3'
(R):5'- AGGTAGTGGTCAGATGAGTCC -3'

Sequencing Primer
(F):5'- CCCCGAGAGAAGGTCTTCATAAG -3'
(R):5'- TAGTGGTCAGATGAGTCCCTCAAC -3'
Posted On2016-09-01