Incidental Mutation 'R5445:Cntn1'
ID427427
Institutional Source Beutler Lab
Gene Symbol Cntn1
Ensembl Gene ENSMUSG00000055022
Gene Namecontactin 1
SynonymsCNTN, F3cam
MMRRC Submission 043010-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5445 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location92051165-92341967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92295077 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 687 (N687Y)
Ref Sequence ENSEMBL: ENSMUSP00000133063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000109] [ENSMUST00000068378] [ENSMUST00000169825]
Predicted Effect probably damaging
Transcript: ENSMUST00000000109
AA Change: N687Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000109
Gene: ENSMUSG00000055022
AA Change: N687Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068378
AA Change: N687Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067842
Gene: ENSMUSG00000055022
AA Change: N687Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169825
AA Change: N687Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133063
Gene: ENSMUSG00000055022
AA Change: N687Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mutations of this gene result in growth retardation, progressive ataxia and death prior to weaning. A targeted null mutation, but not a spontaneous mutation, causes a small cerebellum with abnormalities of the molecular layer and abnormal Purkinje cellaxon morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Abcg5 A T 17: 84,671,129 D300E probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Casp7 A G 19: 56,433,338 probably null Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Cep350 T C 1: 155,894,723 D1807G probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Fra10ac1 T A 19: 38,219,462 D72V possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Kcnh6 T C 11: 106,023,859 Y697H probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mia3 A G 1: 183,336,022 V208A probably benign Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Pdlim5 C T 3: 142,352,734 R83K probably null Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Spdye4c C T 2: 128,596,564 Q281* probably null Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp19 G T 9: 108,497,920 V782F possibly damaging Het
Usp33 T A 3: 152,374,623 S464T probably damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Zfp786 T C 6: 47,819,685 E773G probably damaging Het
Other mutations in Cntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cntn1 APN 15 92250877 missense possibly damaging 0.92
IGL01109:Cntn1 APN 15 92339577 nonsense probably null
IGL01399:Cntn1 APN 15 92305144 missense probably damaging 1.00
IGL01714:Cntn1 APN 15 92253989 nonsense probably null
IGL02052:Cntn1 APN 15 92291703 missense possibly damaging 0.95
IGL02342:Cntn1 APN 15 92246017 missense probably benign 0.01
IGL02507:Cntn1 APN 15 92250979 missense possibly damaging 0.92
IGL02511:Cntn1 APN 15 92216385 start gained probably benign
IGL02702:Cntn1 APN 15 92291601 splice site probably benign
IGL02927:Cntn1 APN 15 92291680 missense probably benign 0.12
IGL02948:Cntn1 APN 15 92246010 missense probably benign 0.01
R0035:Cntn1 UTSW 15 92232088 splice site probably benign
R0084:Cntn1 UTSW 15 92317917 missense probably benign 0.01
R0346:Cntn1 UTSW 15 92232087 splice site probably benign
R0634:Cntn1 UTSW 15 92314563 nonsense probably null
R1348:Cntn1 UTSW 15 92314663 missense probably damaging 1.00
R1613:Cntn1 UTSW 15 92245990 missense possibly damaging 0.60
R1793:Cntn1 UTSW 15 92291671 missense possibly damaging 0.92
R1815:Cntn1 UTSW 15 92250948 missense probably benign 0.00
R1851:Cntn1 UTSW 15 92305140 missense probably damaging 1.00
R1852:Cntn1 UTSW 15 92305140 missense probably damaging 1.00
R2068:Cntn1 UTSW 15 92318062 missense possibly damaging 0.82
R2269:Cntn1 UTSW 15 92294982 splice site probably benign
R4394:Cntn1 UTSW 15 92291764 missense probably damaging 1.00
R4667:Cntn1 UTSW 15 92295079 missense probably damaging 1.00
R4771:Cntn1 UTSW 15 92305091 missense possibly damaging 0.82
R4944:Cntn1 UTSW 15 92228668 missense probably damaging 1.00
R5044:Cntn1 UTSW 15 92242995 missense probably damaging 1.00
R5218:Cntn1 UTSW 15 92339549 missense unknown
R5314:Cntn1 UTSW 15 92295011 missense probably benign 0.01
R5518:Cntn1 UTSW 15 92314653 missense probably benign 0.00
R6849:Cntn1 UTSW 15 92305246 missense probably damaging 0.99
R6885:Cntn1 UTSW 15 92243099 critical splice donor site probably null
R7035:Cntn1 UTSW 15 92314511 missense probably benign 0.04
R7070:Cntn1 UTSW 15 92254036 missense probably damaging 1.00
R7287:Cntn1 UTSW 15 92245952 splice site probably null
R7311:Cntn1 UTSW 15 92232275 critical splice donor site probably null
R7401:Cntn1 UTSW 15 92317989 missense probably benign
R7484:Cntn1 UTSW 15 92254041 missense probably benign 0.00
R7492:Cntn1 UTSW 15 92314542 missense probably benign
R7617:Cntn1 UTSW 15 92246089 missense probably damaging 1.00
R7644:Cntn1 UTSW 15 92310009 missense probably benign 0.14
R7878:Cntn1 UTSW 15 92295053 missense probably damaging 1.00
Z1177:Cntn1 UTSW 15 92309970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAACCCAGAATACATGTGCC -3'
(R):5'- ACATAGTCTCTGGTGTAATGTGCTG -3'

Sequencing Primer
(F):5'- GAATACATGTGCCAACTCTCTAAG -3'
(R):5'- GGCTACACACACATTTCTAGATGAG -3'
Posted On2016-09-01