Incidental Mutation 'R5445:Fra10ac1'
ID427437
Institutional Source Beutler Lab
Gene Symbol Fra10ac1
Ensembl Gene ENSMUSG00000054237
Gene NameFRA10AC1 homolog (human)
Synonyms5730455O13Rik
MMRRC Submission 043010-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R5445 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location38188481-38224138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38219462 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 72 (D72V)
Ref Sequence ENSEMBL: ENSMUSP00000070534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067167]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067167
AA Change: D72V

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070534
Gene: ENSMUSG00000054237
AA Change: D72V

DomainStartEndE-ValueType
Pfam:Fra10Ac1 104 220 7e-56 PFAM
low complexity region 228 237 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 278 288 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear phosphoprotein of unknown function. This gene contains a tandem CGG repeat region within a CpG island that normally consists of 8-14 repeats but can expand to over 200 repeats. The repeat region is within the 5' UTR of some transcript variants, but is intronic to another variant. The expanded repeat allele is a fragile site and becomes hypermethylated, causing a reduction in gene expression. A disease phenotype has not been associated with expanded alleles. This gene is found within the rare FRA10A folate-sensitive fragile site. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Abcg5 A T 17: 84,671,129 D300E probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Casp7 A G 19: 56,433,338 probably null Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Cep350 T C 1: 155,894,723 D1807G probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Cntn1 A T 15: 92,295,077 N687Y probably damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Kcnh6 T C 11: 106,023,859 Y697H probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mia3 A G 1: 183,336,022 V208A probably benign Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Pdlim5 C T 3: 142,352,734 R83K probably null Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Spdye4c C T 2: 128,596,564 Q281* probably null Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp19 G T 9: 108,497,920 V782F possibly damaging Het
Usp33 T A 3: 152,374,623 S464T probably damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Zfp786 T C 6: 47,819,685 E773G probably damaging Het
Other mutations in Fra10ac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Fra10ac1 APN 19 38201564 missense probably damaging 0.99
IGL01784:Fra10ac1 APN 19 38219677 missense probably benign 0.32
IGL03396:Fra10ac1 APN 19 38201546 critical splice donor site probably null
R4349:Fra10ac1 UTSW 19 38199605 missense probably benign 0.00
R5090:Fra10ac1 UTSW 19 38214425 missense probably damaging 1.00
R5234:Fra10ac1 UTSW 19 38215846 missense probably damaging 1.00
R5259:Fra10ac1 UTSW 19 38199662 missense probably benign 0.00
R5768:Fra10ac1 UTSW 19 38207286 missense probably benign 0.02
R6756:Fra10ac1 UTSW 19 38215865 missense probably damaging 1.00
R6831:Fra10ac1 UTSW 19 38207289 missense probably benign 0.38
R7011:Fra10ac1 UTSW 19 38188794 missense probably benign 0.11
R7054:Fra10ac1 UTSW 19 38224119 start gained probably benign
R7530:Fra10ac1 UTSW 19 38215905 nonsense probably null
R7561:Fra10ac1 UTSW 19 38221876 missense probably damaging 1.00
R7715:Fra10ac1 UTSW 19 38189838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCAAGCCTGACAAGAAC -3'
(R):5'- AGGTGGCCCATAAACAAGTC -3'

Sequencing Primer
(F):5'- CCCTTTTAAGTTCCTGGACTTTAAAG -3'
(R):5'- CAGACTTGCTCGACAGGTGTG -3'
Posted On2016-09-01