Incidental Mutation 'R5411:Cacna1s'
ID 427441
Institutional Source Beutler Lab
Gene Symbol Cacna1s
Ensembl Gene ENSMUSG00000026407
Gene Name calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms sj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd
MMRRC Submission 042980-MU
Accession Numbers

Genbank: NM_001081023; MGI: 88294

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5411 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 136052750-136119822 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 136105811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 1275 (V1275L)
Ref Sequence ENSEMBL: ENSMUSP00000125278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000112064
AA Change: V1275L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: V1275L

DomainStartEndE-ValueType
Pfam:Ion_trans 50 345 4.3e-68 PFAM
Pfam:Ion_trans 431 672 4.5e-56 PFAM
Pfam:PKD_channel 516 667 1.9e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
Pfam:Ion_trans 798 1076 2.6e-65 PFAM
Pfam:Ion_trans 1117 1392 1.2e-71 PFAM
Pfam:PKD_channel 1126 1387 8.4e-13 PFAM
Pfam:GPHH 1394 1463 2.3e-38 PFAM
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Pfam:CAC1F_C 1756 1845 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112068
AA Change: V1256L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: V1256L

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.1e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.7e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 3.9e-53 PFAM
Pfam:Ion_trans 1152 1361 6.7e-66 PFAM
Pfam:PKD_channel 1201 1368 8.4e-10 PFAM
Blast:EFh 1382 1410 5e-8 BLAST
Ca_chan_IQ 1496 1529 3.71e-14 SMART
low complexity region 1638 1650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160641
AA Change: V1275L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: V1275L

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.3e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.8e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 4e-53 PFAM
Pfam:PKD_channel 1126 1387 6.1e-12 PFAM
Pfam:Ion_trans 1152 1380 9e-65 PFAM
Blast:EFh 1401 1429 5e-8 BLAST
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161700
Predicted Effect probably benign
Transcript: ENSMUST00000161865
AA Change: V1009L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407
AA Change: V1009L

DomainStartEndE-ValueType
Pfam:Ion_trans 3 98 1.1e-21 PFAM
Pfam:Ion_trans 184 425 3.3e-56 PFAM
Pfam:PKD_channel 267 420 1.8e-7 PFAM
low complexity region 428 438 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
Pfam:Ion_trans 551 829 1.9e-65 PFAM
Pfam:Ion_trans 870 1126 5.4e-72 PFAM
Pfam:PKD_channel 954 1121 7.2e-10 PFAM
Pfam:GPHH 1128 1197 1.8e-38 PFAM
Ca_chan_IQ 1249 1282 3.71e-14 SMART
low complexity region 1391 1403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C A 9: 53,582,646 V392F probably damaging Het
Ache C T 5: 137,290,064 P11S possibly damaging Het
Ache T A 5: 137,290,430 probably null Het
Acoxl A T 2: 127,854,901 H23L probably benign Het
Adamtsl1 G A 4: 86,388,413 probably null Het
Adar T A 3: 89,739,212 F45I probably benign Het
Adgrf4 A C 17: 42,667,213 L413R probably damaging Het
Atp6v1g3 A T 1: 138,287,889 I96F probably benign Het
Brsk2 T C 7: 142,000,857 M653T probably benign Het
Ces3b T C 8: 105,088,632 V5A possibly damaging Het
Chpt1 A T 10: 88,477,107 I281N probably damaging Het
Col10a1 A G 10: 34,394,557 E175G probably damaging Het
Col27a1 T C 4: 63,224,665 S197P probably damaging Het
Csmd1 T A 8: 15,910,471 R3315W probably damaging Het
Ctnna2 T C 6: 77,114,931 E443G probably damaging Het
Dhx9 G T 1: 153,481,223 S93R probably benign Het
Efcab8 A G 2: 153,783,756 H112R probably damaging Het
Eif3d A T 15: 77,959,687 N486K probably damaging Het
Esp8 C T 17: 40,530,018 R57* probably null Het
Eya3 A T 4: 132,689,779 I130F probably damaging Het
Fat2 G T 11: 55,252,226 L4266I probably benign Het
Fras1 T A 5: 96,645,160 D983E probably benign Het
Gcc2 T C 10: 58,270,969 S640P probably damaging Het
Gm13119 T A 4: 144,361,637 M1K probably null Het
Gys2 C T 6: 142,448,421 G464R probably damaging Het
Heatr5a G A 12: 51,888,243 T1659I probably damaging Het
Il17ra A G 6: 120,481,442 D518G probably damaging Het
Kcnk13 A G 12: 100,061,251 Y195C probably damaging Het
Kmt2a T A 9: 44,848,485 H722L probably damaging Het
Luzp1 C A 4: 136,543,342 Q959K possibly damaging Het
Mep1b T A 18: 21,086,249 H153Q probably damaging Het
Mfsd13b A T 7: 121,000,123 I381F probably benign Het
Mvk A G 5: 114,458,973 T334A probably benign Het
Naa30 T C 14: 49,187,551 V320A probably damaging Het
Naip5 C T 13: 100,245,746 G152S possibly damaging Het
Neb A C 2: 52,295,372 S949R probably damaging Het
Nfya A T 17: 48,392,018 I214N possibly damaging Het
Nsf G T 11: 103,882,811 N292K probably damaging Het
Nup133 T C 8: 123,927,206 T505A probably benign Het
Olfr1178 A G 2: 88,391,261 T5A probably benign Het
Olfr1231 A C 2: 89,303,576 S5R probably benign Het
Olfr1413 A T 1: 92,573,824 T218S probably benign Het
Olfr192 T A 16: 59,098,704 H96L unknown Het
P4ha3 A T 7: 100,293,815 R136W probably damaging Het
Parp12 A G 6: 39,090,208 V550A probably damaging Het
Phf11a T C 14: 59,294,938 D16G probably benign Het
Rab3gap2 A G 1: 185,277,145 probably null Het
Sco1 A G 11: 67,063,958 D263G probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sfpq T A 4: 127,021,723 S103T unknown Het
Shisa7 G A 7: 4,829,976 R263C probably damaging Het
Ssc4d T A 5: 135,963,400 D144V probably benign Het
Stxbp5l G A 16: 37,129,851 P1044L probably damaging Het
Tgm6 G A 2: 130,145,196 R528Q probably benign Het
Tlr3 A T 8: 45,396,955 H892Q probably benign Het
Tmc2 A G 2: 130,240,115 H406R probably damaging Het
Tmtc1 A T 6: 148,443,899 probably null Het
Ttc19 A G 11: 62,284,151 I139M probably benign Het
Utrn G A 10: 12,649,185 R2185C probably benign Het
Wdfy4 T C 14: 32,960,002 N3004S probably damaging Het
Wdr3 C A 3: 100,142,984 G746W probably damaging Het
Zfp335 T A 2: 164,902,245 Q500L probably damaging Het
Zfp804b A T 5: 6,770,071 D961E probably benign Het
Zkscan16 CTTCAGCTTTCA CTTCA 4: 58,956,745 probably null Het
Other mutations in Cacna1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Cacna1s APN 1 136084273 nonsense probably null
IGL00517:Cacna1s APN 1 136087339 missense probably damaging 1.00
IGL01316:Cacna1s APN 1 136118964 missense probably benign 0.01
IGL01348:Cacna1s APN 1 136075152 missense possibly damaging 0.95
IGL01739:Cacna1s APN 1 136097132 critical splice donor site probably null
IGL01773:Cacna1s APN 1 136118753 missense probably benign 0.32
IGL02056:Cacna1s APN 1 136119000 missense probably benign
IGL02262:Cacna1s APN 1 136108129 missense probably damaging 0.98
IGL02324:Cacna1s APN 1 136075176 splice site probably benign
IGL02352:Cacna1s APN 1 136093252 splice site probably benign
IGL02359:Cacna1s APN 1 136093252 splice site probably benign
IGL02370:Cacna1s APN 1 136085347 missense probably damaging 1.00
IGL02377:Cacna1s APN 1 136068994 missense probably damaging 1.00
IGL02474:Cacna1s APN 1 136118380 missense probably benign
IGL02606:Cacna1s APN 1 136079519 missense probably damaging 0.99
IGL02833:Cacna1s APN 1 136071005 missense probably benign 0.03
IGL02974:Cacna1s APN 1 136092617 missense possibly damaging 0.78
IGL03064:Cacna1s APN 1 136111993 missense probably damaging 1.00
IGL03093:Cacna1s APN 1 136116064 missense probably benign 0.00
IGL03286:Cacna1s APN 1 136077659 missense probably benign
brookstone UTSW 1 136092694 missense probably benign 0.01
flyfish UTSW 1 136116061 missense probably benign 0.21
forelle UTSW 1 136095858 missense probably damaging 0.99
river UTSW 1 136105844 missense possibly damaging 0.88
stream UTSW 1 136105814 missense probably damaging 1.00
BB009:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
BB019:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
G1Funyon:Cacna1s UTSW 1 136073441 unclassified probably benign
N/A:Cacna1s UTSW 1 136073509 missense probably benign 0.00
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0240:Cacna1s UTSW 1 136073496 unclassified probably benign
R0255:Cacna1s UTSW 1 136118806 missense possibly damaging 0.93
R0302:Cacna1s UTSW 1 136100604 missense probably benign 0.01
R0319:Cacna1s UTSW 1 136070717 missense probably damaging 0.99
R0411:Cacna1s UTSW 1 136113303 missense probably damaging 1.00
R0413:Cacna1s UTSW 1 136098209 missense probably benign 0.00
R0482:Cacna1s UTSW 1 136113394 missense probably benign
R0491:Cacna1s UTSW 1 136089008 splice site probably benign
R0518:Cacna1s UTSW 1 136076859 missense probably benign
R0717:Cacna1s UTSW 1 136098291 missense probably damaging 1.00
R0725:Cacna1s UTSW 1 136098526 splice site probably benign
R0815:Cacna1s UTSW 1 136112957 missense possibly damaging 0.95
R1384:Cacna1s UTSW 1 136094971 missense probably benign 0.02
R1518:Cacna1s UTSW 1 136098551 missense probably damaging 1.00
R1548:Cacna1s UTSW 1 136110937 missense probably damaging 1.00
R1725:Cacna1s UTSW 1 136098623 missense probably damaging 1.00
R1728:Cacna1s UTSW 1 136118716 missense probably benign
R1729:Cacna1s UTSW 1 136118716 missense probably benign
R1730:Cacna1s UTSW 1 136118716 missense probably benign
R1739:Cacna1s UTSW 1 136118716 missense probably benign
R1762:Cacna1s UTSW 1 136118716 missense probably benign
R1783:Cacna1s UTSW 1 136118716 missense probably benign
R1784:Cacna1s UTSW 1 136118716 missense probably benign
R1785:Cacna1s UTSW 1 136118716 missense probably benign
R1800:Cacna1s UTSW 1 136076854 missense probably benign
R1924:Cacna1s UTSW 1 136089017 splice site probably null
R1969:Cacna1s UTSW 1 136119095 missense probably benign 0.42
R2072:Cacna1s UTSW 1 136079504 missense probably benign
R2380:Cacna1s UTSW 1 136095848 missense probably damaging 1.00
R3110:Cacna1s UTSW 1 136075093 nonsense probably null
R3112:Cacna1s UTSW 1 136075093 nonsense probably null
R3151:Cacna1s UTSW 1 136105794 missense probably damaging 1.00
R3696:Cacna1s UTSW 1 136105814 missense probably damaging 1.00
R3722:Cacna1s UTSW 1 136069042 missense possibly damaging 0.77
R3804:Cacna1s UTSW 1 136107018 missense possibly damaging 0.85
R3813:Cacna1s UTSW 1 136085347 missense probably damaging 1.00
R3905:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3907:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3909:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R4170:Cacna1s UTSW 1 136108195 missense probably damaging 1.00
R4329:Cacna1s UTSW 1 136119033 missense probably benign 0.00
R4485:Cacna1s UTSW 1 136076852 missense probably damaging 1.00
R4581:Cacna1s UTSW 1 136070970 splice site probably null
R4719:Cacna1s UTSW 1 136118652 splice site probably benign
R4816:Cacna1s UTSW 1 136115269 missense possibly damaging 0.89
R4909:Cacna1s UTSW 1 136079604 missense probably damaging 0.99
R4917:Cacna1s UTSW 1 136101564 critical splice donor site probably null
R5296:Cacna1s UTSW 1 136095785 missense probably benign 0.11
R5503:Cacna1s UTSW 1 136086742 missense probably damaging 1.00
R5533:Cacna1s UTSW 1 136098375 critical splice donor site probably null
R5714:Cacna1s UTSW 1 136112066 missense probably benign 0.44
R5775:Cacna1s UTSW 1 136108122 missense probably damaging 1.00
R5814:Cacna1s UTSW 1 136107142 missense probably benign 0.31
R5820:Cacna1s UTSW 1 136079604 missense probably damaging 1.00
R5822:Cacna1s UTSW 1 136112078 missense probably damaging 1.00
R5877:Cacna1s UTSW 1 136100667 missense probably damaging 0.99
R5923:Cacna1s UTSW 1 136076822 missense possibly damaging 0.79
R6021:Cacna1s UTSW 1 136106487 missense probably benign 0.15
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6056:Cacna1s UTSW 1 136105836 missense probably damaging 1.00
R6143:Cacna1s UTSW 1 136076758 missense probably damaging 0.99
R6222:Cacna1s UTSW 1 136104622 missense probably benign 0.00
R6237:Cacna1s UTSW 1 136105844 missense possibly damaging 0.88
R6274:Cacna1s UTSW 1 136089045 missense probably benign 0.02
R6609:Cacna1s UTSW 1 136113391 missense probably benign 0.30
R6626:Cacna1s UTSW 1 136094965 missense probably damaging 1.00
R6838:Cacna1s UTSW 1 136084437 missense possibly damaging 0.91
R6848:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6849:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6850:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6851:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6868:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6879:Cacna1s UTSW 1 136115959 missense probably benign 0.12
R6893:Cacna1s UTSW 1 136077693 missense probably benign 0.05
R7017:Cacna1s UTSW 1 136095858 missense probably damaging 0.99
R7228:Cacna1s UTSW 1 136071059 missense possibly damaging 0.90
R7283:Cacna1s UTSW 1 136073708 missense probably damaging 1.00
R7357:Cacna1s UTSW 1 136071021 missense probably damaging 0.99
R7385:Cacna1s UTSW 1 136092633 missense probably damaging 0.99
R7421:Cacna1s UTSW 1 136086802 missense probably damaging 1.00
R7505:Cacna1s UTSW 1 136085449 nonsense probably null
R7519:Cacna1s UTSW 1 136070756 missense probably damaging 0.99
R7675:Cacna1s UTSW 1 136110874 missense probably damaging 1.00
R7746:Cacna1s UTSW 1 136069018 missense probably damaging 0.99
R7779:Cacna1s UTSW 1 136119029 missense probably damaging 1.00
R7850:Cacna1s UTSW 1 136071048 missense probably damaging 1.00
R7932:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
R7935:Cacna1s UTSW 1 136092595 missense possibly damaging 0.62
R7950:Cacna1s UTSW 1 136100625 missense probably benign 0.01
R7969:Cacna1s UTSW 1 136076732 missense probably damaging 1.00
R8083:Cacna1s UTSW 1 136095791 missense possibly damaging 0.91
R8101:Cacna1s UTSW 1 136118665 missense probably benign 0.02
R8123:Cacna1s UTSW 1 136108179 missense probably damaging 1.00
R8191:Cacna1s UTSW 1 136108155 missense probably damaging 1.00
R8194:Cacna1s UTSW 1 136077692 missense probably benign 0.33
R8251:Cacna1s UTSW 1 136086723 missense probably damaging 1.00
R8265:Cacna1s UTSW 1 136092626 nonsense probably null
R8301:Cacna1s UTSW 1 136073441 unclassified probably benign
R8310:Cacna1s UTSW 1 136087337 missense probably damaging 1.00
R8359:Cacna1s UTSW 1 136116061 missense probably benign 0.21
R8461:Cacna1s UTSW 1 136073702 missense possibly damaging 0.53
R8553:Cacna1s UTSW 1 136091802 missense possibly damaging 0.93
R8743:Cacna1s UTSW 1 136105548 missense probably damaging 1.00
R8766:Cacna1s UTSW 1 136075143 missense probably damaging 1.00
R8884:Cacna1s UTSW 1 136115243 missense probably benign 0.05
R8897:Cacna1s UTSW 1 136117654 missense probably benign 0.01
R8939:Cacna1s UTSW 1 136086806 critical splice donor site probably null
R8953:Cacna1s UTSW 1 136097432 missense possibly damaging 0.94
R9039:Cacna1s UTSW 1 136088319 missense probably benign
R9058:Cacna1s UTSW 1 136070698 nonsense probably null
R9137:Cacna1s UTSW 1 136069006 missense possibly damaging 0.89
R9332:Cacna1s UTSW 1 136092714 nonsense probably null
R9416:Cacna1s UTSW 1 136094951 missense possibly damaging 0.88
R9427:Cacna1s UTSW 1 136084352 missense probably benign 0.30
R9446:Cacna1s UTSW 1 136117624 missense probably benign 0.00
R9564:Cacna1s UTSW 1 136118778 missense probably benign
R9620:Cacna1s UTSW 1 136108171 missense probably damaging 1.00
X0025:Cacna1s UTSW 1 136115970 missense probably benign 0.00
Z1176:Cacna1s UTSW 1 136107084 nonsense probably null
Z1177:Cacna1s UTSW 1 136117686 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCTGGAAACTGACCCAGC -3'
(R):5'- CCTCTGTCAGATTGGAACTGACC -3'

Sequencing Primer
(F):5'- ATGCCACTAGCCCAAGGTG -3'
(R):5'- AGATTGGAACTGACCCCTTG -3'
Posted On 2016-09-01