Incidental Mutation 'R5411:Adamtsl1'
ID427459
Institutional Source Beutler Lab
Gene Symbol Adamtsl1
Ensembl Gene ENSMUSG00000066113
Gene NameADAMTS-like 1
Synonyms5930437A14Rik, 6720426B09Rik, punctin-1
MMRRC Submission 042980-MU
Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5411 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location85514172-86428385 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 86388413 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000107178] [ENSMUST00000141889] [ENSMUST00000141889]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107177
Predicted Effect probably null
Transcript: ENSMUST00000107178
SMART Domains Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 362 421 2.05e-2 SMART
TSP1 422 476 3.99e-4 SMART
TSP1 508 567 6.39e-3 SMART
TSP1 593 650 7.86e-3 SMART
TSP1 652 712 3.78e-5 SMART
TSP1 715 772 2.66e-2 SMART
TSP1 774 833 1.62e-4 SMART
IGc2 873 937 4.19e-6 SMART
low complexity region 1123 1142 N/A INTRINSIC
IGc2 1175 1240 1.31e-7 SMART
IGc2 1282 1351 7.81e-15 SMART
IGc2 1400 1467 2.39e-10 SMART
TSP1 1481 1537 2.12e-1 SMART
TSP1 1540 1599 1.74e-4 SMART
TSP1 1600 1658 8.2e0 SMART
TSP1 1660 1717 1.96e-1 SMART
Pfam:PLAC 1721 1751 1.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107178
SMART Domains Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 362 421 2.05e-2 SMART
TSP1 422 476 3.99e-4 SMART
TSP1 508 567 6.39e-3 SMART
TSP1 593 650 7.86e-3 SMART
TSP1 652 712 3.78e-5 SMART
TSP1 715 772 2.66e-2 SMART
TSP1 774 833 1.62e-4 SMART
IGc2 873 937 4.19e-6 SMART
low complexity region 1123 1142 N/A INTRINSIC
IGc2 1175 1240 1.31e-7 SMART
IGc2 1282 1351 7.81e-15 SMART
IGc2 1400 1467 2.39e-10 SMART
TSP1 1481 1537 2.12e-1 SMART
TSP1 1540 1599 1.74e-4 SMART
TSP1 1600 1658 8.2e0 SMART
TSP1 1660 1717 1.96e-1 SMART
Pfam:PLAC 1721 1751 1.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141889
SMART Domains Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 379 438 2.05e-2 SMART
TSP1 439 493 3.99e-4 SMART
TSP1 525 584 6.39e-3 SMART
TSP1 610 667 7.86e-3 SMART
TSP1 707 764 2.66e-2 SMART
TSP1 766 825 1.62e-4 SMART
IGc2 865 929 4.19e-6 SMART
low complexity region 1115 1134 N/A INTRINSIC
IGc2 1167 1232 1.31e-7 SMART
IGc2 1274 1343 7.81e-15 SMART
IGc2 1392 1459 2.39e-10 SMART
TSP1 1473 1529 2.12e-1 SMART
TSP1 1532 1591 1.74e-4 SMART
TSP1 1592 1650 8.2e0 SMART
TSP1 1652 1709 1.96e-1 SMART
Pfam:PLAC 1712 1744 5.6e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141889
SMART Domains Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 379 438 2.05e-2 SMART
TSP1 439 493 3.99e-4 SMART
TSP1 525 584 6.39e-3 SMART
TSP1 610 667 7.86e-3 SMART
TSP1 707 764 2.66e-2 SMART
TSP1 766 825 1.62e-4 SMART
IGc2 865 929 4.19e-6 SMART
low complexity region 1115 1134 N/A INTRINSIC
IGc2 1167 1232 1.31e-7 SMART
IGc2 1274 1343 7.81e-15 SMART
IGc2 1392 1459 2.39e-10 SMART
TSP1 1473 1529 2.12e-1 SMART
TSP1 1532 1591 1.74e-4 SMART
TSP1 1592 1650 8.2e0 SMART
TSP1 1652 1709 1.96e-1 SMART
Pfam:PLAC 1712 1744 5.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C A 9: 53,582,646 V392F probably damaging Het
Ache C T 5: 137,290,064 P11S possibly damaging Het
Ache T A 5: 137,290,430 probably null Het
Acoxl A T 2: 127,854,901 H23L probably benign Het
Adar T A 3: 89,739,212 F45I probably benign Het
Adgrf4 A C 17: 42,667,213 L413R probably damaging Het
Atp6v1g3 A T 1: 138,287,889 I96F probably benign Het
Brsk2 T C 7: 142,000,857 M653T probably benign Het
Cacna1s G T 1: 136,105,811 V1275L probably benign Het
Ces3b T C 8: 105,088,632 V5A possibly damaging Het
Chpt1 A T 10: 88,477,107 I281N probably damaging Het
Col10a1 A G 10: 34,394,557 E175G probably damaging Het
Col27a1 T C 4: 63,224,665 S197P probably damaging Het
Csmd1 T A 8: 15,910,471 R3315W probably damaging Het
Ctnna2 T C 6: 77,114,931 E443G probably damaging Het
Dhx9 G T 1: 153,481,223 S93R probably benign Het
Efcab8 A G 2: 153,783,756 H112R probably damaging Het
Eif3d A T 15: 77,959,687 N486K probably damaging Het
Esp8 C T 17: 40,530,018 R57* probably null Het
Eya3 A T 4: 132,689,779 I130F probably damaging Het
Fat2 G T 11: 55,252,226 L4266I probably benign Het
Fras1 T A 5: 96,645,160 D983E probably benign Het
Gcc2 T C 10: 58,270,969 S640P probably damaging Het
Gm13119 T A 4: 144,361,637 M1K probably null Het
Gys2 C T 6: 142,448,421 G464R probably damaging Het
Heatr5a G A 12: 51,888,243 T1659I probably damaging Het
Il17ra A G 6: 120,481,442 D518G probably damaging Het
Kcnk13 A G 12: 100,061,251 Y195C probably damaging Het
Kmt2a T A 9: 44,848,485 H722L probably damaging Het
Luzp1 C A 4: 136,543,342 Q959K possibly damaging Het
Mep1b T A 18: 21,086,249 H153Q probably damaging Het
Mfsd13b A T 7: 121,000,123 I381F probably benign Het
Mvk A G 5: 114,458,973 T334A probably benign Het
Naa30 T C 14: 49,187,551 V320A probably damaging Het
Naip5 C T 13: 100,245,746 G152S possibly damaging Het
Neb A C 2: 52,295,372 S949R probably damaging Het
Nfya A T 17: 48,392,018 I214N possibly damaging Het
Nsf G T 11: 103,882,811 N292K probably damaging Het
Nup133 T C 8: 123,927,206 T505A probably benign Het
Olfr1178 A G 2: 88,391,261 T5A probably benign Het
Olfr1231 A C 2: 89,303,576 S5R probably benign Het
Olfr1413 A T 1: 92,573,824 T218S probably benign Het
Olfr192 T A 16: 59,098,704 H96L unknown Het
P4ha3 A T 7: 100,293,815 R136W probably damaging Het
Parp12 A G 6: 39,090,208 V550A probably damaging Het
Phf11a T C 14: 59,294,938 D16G probably benign Het
Rab3gap2 A G 1: 185,277,145 probably null Het
Sco1 A G 11: 67,063,958 D263G probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sfpq T A 4: 127,021,723 S103T unknown Het
Shisa7 G A 7: 4,829,976 R263C probably damaging Het
Ssc4d T A 5: 135,963,400 D144V probably benign Het
Stxbp5l G A 16: 37,129,851 P1044L probably damaging Het
Tgm6 G A 2: 130,145,196 R528Q probably benign Het
Tlr3 A T 8: 45,396,955 H892Q probably benign Het
Tmc2 A G 2: 130,240,115 H406R probably damaging Het
Tmtc1 A T 6: 148,443,899 probably null Het
Ttc19 A G 11: 62,284,151 I139M probably benign Het
Utrn G A 10: 12,649,185 R2185C probably benign Het
Wdfy4 T C 14: 32,960,002 N3004S probably damaging Het
Wdr3 C A 3: 100,142,984 G746W probably damaging Het
Zfp335 T A 2: 164,902,245 Q500L probably damaging Het
Zfp804b A T 5: 6,770,071 D961E probably benign Het
Zkscan16 CTTCAGCTTTCA CTTCA 4: 58,956,745 probably null Het
Other mutations in Adamtsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Adamtsl1 APN 4 86385640 missense probably benign 0.01
IGL00741:Adamtsl1 APN 4 86276948 missense probably damaging 1.00
IGL00770:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00774:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00826:Adamtsl1 APN 4 86156804 missense probably damaging 1.00
IGL00938:Adamtsl1 APN 4 86342278 missense possibly damaging 0.93
IGL01012:Adamtsl1 APN 4 86342189 missense possibly damaging 0.93
IGL01728:Adamtsl1 APN 4 86110837 missense probably damaging 1.00
IGL01801:Adamtsl1 APN 4 86199322 missense probably benign 0.23
IGL01922:Adamtsl1 APN 4 86249902 missense probably damaging 1.00
IGL02006:Adamtsl1 APN 4 86199345 missense probably damaging 1.00
IGL02192:Adamtsl1 APN 4 86228016 missense probably damaging 1.00
IGL02351:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02358:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02373:Adamtsl1 APN 4 86249805 missense probably damaging 1.00
IGL02660:Adamtsl1 APN 4 86232610 missense probably damaging 1.00
IGL02964:Adamtsl1 APN 4 86424357 missense probably damaging 1.00
IGL03233:Adamtsl1 APN 4 86342120 missense probably damaging 1.00
IGL03297:Adamtsl1 APN 4 86423426 missense probably damaging 0.98
IGL03326:Adamtsl1 APN 4 86252748 splice site probably benign
PIT4378001:Adamtsl1 UTSW 4 86199364 missense possibly damaging 0.93
PIT4418001:Adamtsl1 UTSW 4 86243724 missense probably damaging 1.00
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0132:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0453:Adamtsl1 UTSW 4 86232615 missense probably damaging 1.00
R0480:Adamtsl1 UTSW 4 86252818 missense probably benign 0.08
R0496:Adamtsl1 UTSW 4 86341198 missense probably damaging 1.00
R0538:Adamtsl1 UTSW 4 86343121 missense probably benign 0.27
R0547:Adamtsl1 UTSW 4 86356355 missense probably benign 0.37
R0567:Adamtsl1 UTSW 4 86228016 missense probably damaging 1.00
R0568:Adamtsl1 UTSW 4 86418552 missense probably damaging 1.00
R0639:Adamtsl1 UTSW 4 86277143 missense probably damaging 1.00
R0931:Adamtsl1 UTSW 4 86249847 missense probably benign 0.05
R1186:Adamtsl1 UTSW 4 86388509 missense probably benign 0.00
R1387:Adamtsl1 UTSW 4 86374993 splice site probably benign
R1459:Adamtsl1 UTSW 4 86425865 missense probably damaging 1.00
R1518:Adamtsl1 UTSW 4 86342603 missense probably damaging 0.99
R1532:Adamtsl1 UTSW 4 86248065 missense probably benign 0.02
R1603:Adamtsl1 UTSW 4 86415530 missense probably benign
R1931:Adamtsl1 UTSW 4 86342411 missense possibly damaging 0.62
R2086:Adamtsl1 UTSW 4 86228012 missense probably damaging 1.00
R2221:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2223:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2396:Adamtsl1 UTSW 4 86343119 nonsense probably null
R2397:Adamtsl1 UTSW 4 86199357 missense probably damaging 1.00
R2426:Adamtsl1 UTSW 4 86156788 missense probably benign 0.01
R3121:Adamtsl1 UTSW 4 86337009 missense probably damaging 1.00
R3715:Adamtsl1 UTSW 4 86216976 missense probably benign 0.01
R3848:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3849:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3850:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R4194:Adamtsl1 UTSW 4 86054008 intron probably benign
R4354:Adamtsl1 UTSW 4 86156684 missense probably damaging 1.00
R4795:Adamtsl1 UTSW 4 86243769 critical splice donor site probably null
R4830:Adamtsl1 UTSW 4 86356382 missense probably damaging 0.97
R4874:Adamtsl1 UTSW 4 86342492 missense possibly damaging 0.94
R4939:Adamtsl1 UTSW 4 86243725 missense possibly damaging 0.95
R4942:Adamtsl1 UTSW 4 86341214 nonsense probably null
R4947:Adamtsl1 UTSW 4 85764800 missense possibly damaging 0.93
R4960:Adamtsl1 UTSW 4 86424173 nonsense probably null
R4971:Adamtsl1 UTSW 4 86336931 missense probably damaging 1.00
R5141:Adamtsl1 UTSW 4 86156850 missense possibly damaging 0.77
R5213:Adamtsl1 UTSW 4 86385628 missense possibly damaging 0.89
R5237:Adamtsl1 UTSW 4 86385669 critical splice donor site probably null
R5250:Adamtsl1 UTSW 4 86216945 nonsense probably null
R5554:Adamtsl1 UTSW 4 86276945 missense possibly damaging 0.69
R5631:Adamtsl1 UTSW 4 86276923 nonsense probably null
R5739:Adamtsl1 UTSW 4 86232664 missense probably damaging 1.00
R5905:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6028:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6044:Adamtsl1 UTSW 4 86212691 missense probably damaging 1.00
R6261:Adamtsl1 UTSW 4 86336878 missense probably benign 0.09
R6300:Adamtsl1 UTSW 4 86248017 missense probably damaging 1.00
R6332:Adamtsl1 UTSW 4 86217011 missense probably damaging 0.96
R6560:Adamtsl1 UTSW 4 86336893 missense probably damaging 1.00
R6693:Adamtsl1 UTSW 4 86342886 missense probably benign 0.27
R6736:Adamtsl1 UTSW 4 86342247 missense probably damaging 1.00
R6964:Adamtsl1 UTSW 4 86156854 missense probably damaging 1.00
R7064:Adamtsl1 UTSW 4 86342041 missense possibly damaging 0.80
R7434:Adamtsl1 UTSW 4 86425878 missense probably damaging 0.99
R7477:Adamtsl1 UTSW 4 86415651 missense probably damaging 1.00
R7545:Adamtsl1 UTSW 4 85764855 missense probably damaging 1.00
R7556:Adamtsl1 UTSW 4 86277121 missense probably benign 0.19
R7580:Adamtsl1 UTSW 4 86054064 missense possibly damaging 0.53
R7593:Adamtsl1 UTSW 4 86341213 missense probably damaging 1.00
R7710:Adamtsl1 UTSW 4 86232573 missense
Predicted Primers PCR Primer
(F):5'- AGTGAGAACTCCTGAGATTCACAG -3'
(R):5'- TTTTGCCCAATGTTTCAGAGG -3'

Sequencing Primer
(F):5'- AGACCTTGTTATCTCAGGCATCAGG -3'
(R):5'- TTCAGAGGGTTGGACTCACC -3'
Posted On2016-09-01