Incidental Mutation 'R5412:Hsd3b2'
ID427516
Institutional Source Beutler Lab
Gene Symbol Hsd3b2
Ensembl Gene ENSMUSG00000063730
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Synonyms
MMRRC Submission 042981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5412 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location98709255-98724543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98711892 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 246 (S246P)
Ref Sequence ENSEMBL: ENSMUSP00000136533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107021] [ENSMUST00000107022] [ENSMUST00000177651]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107021
AA Change: S246P

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102635
Gene: ENSMUSG00000063730
AA Change: S246P

DomainStartEndE-ValueType
Pfam:KR 5 130 3.9e-7 PFAM
Pfam:adh_short 5 133 5.6e-8 PFAM
Pfam:Polysacc_synt_2 6 135 2.1e-13 PFAM
Pfam:NmrA 6 139 7.7e-8 PFAM
Pfam:NAD_binding_10 6 207 1.4e-9 PFAM
Pfam:Epimerase 6 254 2.5e-26 PFAM
Pfam:3Beta_HSD 7 288 1.2e-112 PFAM
Pfam:NAD_binding_4 8 221 1.7e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107022
AA Change: S246P

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102636
Gene: ENSMUSG00000063730
AA Change: S246P

DomainStartEndE-ValueType
Pfam:KR 5 130 3.9e-7 PFAM
Pfam:adh_short 5 133 5.6e-8 PFAM
Pfam:Polysacc_synt_2 6 135 2.1e-13 PFAM
Pfam:NmrA 6 139 7.7e-8 PFAM
Pfam:NAD_binding_10 6 207 1.4e-9 PFAM
Pfam:Epimerase 6 254 2.5e-26 PFAM
Pfam:3Beta_HSD 7 288 1.2e-112 PFAM
Pfam:NAD_binding_4 8 221 1.7e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177651
AA Change: S246P

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136533
Gene: ENSMUSG00000063730
AA Change: S246P

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 6 136 1.2e-13 PFAM
Pfam:NmrA 6 140 1.7e-7 PFAM
Pfam:Epimerase 6 249 2.1e-25 PFAM
Pfam:GDP_Man_Dehyd 7 187 2.7e-13 PFAM
Pfam:3Beta_HSD 7 288 8.2e-114 PFAM
Pfam:NAD_binding_4 8 223 1.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,978,752 N36Y probably damaging Het
Ankfn1 T A 11: 89,505,181 E246D probably benign Het
Arid1a T C 4: 133,719,602 probably benign Het
Bbs7 A T 3: 36,599,373 D300E probably benign Het
BC025446 A T 15: 75,217,820 E59V probably damaging Het
C3 T C 17: 57,220,187 D754G probably benign Het
Ccpg1 A T 9: 73,010,306 Q240L probably damaging Het
Cdk13 G A 13: 17,766,530 P650S probably damaging Het
Celsr2 G T 3: 108,399,995 S1933Y probably damaging Het
Cep135 T A 5: 76,616,862 H562Q probably benign Het
Cyp26a1 G T 19: 37,701,182 C442F probably damaging Het
Dnah7a T C 1: 53,635,344 S425G probably benign Het
Espn C T 4: 152,128,125 V752M probably damaging Het
Glyr1 A G 16: 5,036,433 S113P possibly damaging Het
Gm11127 C T 17: 36,056,044 C369Y probably benign Het
Grk4 A T 5: 34,745,268 Y388F probably benign Het
Heca C A 10: 17,902,296 V518F probably damaging Het
Hmcn2 C T 2: 31,346,617 P391S possibly damaging Het
Hnrnpl A G 7: 28,811,104 probably benign Het
Ifna11 C T 4: 88,820,143 P62L probably damaging Het
Katnal2 A T 18: 77,002,435 V292D probably damaging Het
Krt16 T A 11: 100,246,767 I371F probably damaging Het
Map10 A T 8: 125,670,985 L372F probably damaging Het
Megf10 A T 18: 57,191,147 M87L probably damaging Het
Ncoa6 T C 2: 155,407,781 H1201R possibly damaging Het
Ndc80 C A 17: 71,514,231 D241Y probably damaging Het
Ndufs1 T C 1: 63,166,349 M94V possibly damaging Het
Nkx2-6 G T 14: 69,174,746 R121L probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr2 A G 7: 107,001,635 V75A probably damaging Het
Otop1 A G 5: 38,297,984 I241V probably benign Het
Panx2 C A 15: 89,068,932 P542H possibly damaging Het
Pcdha5 C A 18: 36,962,457 P673Q probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Prdx6 A T 1: 161,244,290 I102N probably damaging Het
Prkd3 T A 17: 78,954,711 I725F possibly damaging Het
Selenon T C 4: 134,542,438 N395S probably benign Het
Serpinb8 G A 1: 107,605,886 E224K probably benign Het
Serpinb9b A G 13: 33,029,513 M18V probably benign Het
Smc6 A G 12: 11,285,399 E318G possibly damaging Het
Srrt A T 5: 137,296,287 Y786N probably damaging Het
Stk36 G T 1: 74,605,456 probably null Het
Stpg1 T A 4: 135,525,475 L179Q possibly damaging Het
Stra8 G A 6: 34,930,950 M1I probably null Het
Tiam1 G T 16: 89,884,865 H408Q possibly damaging Het
Tm2d1 G A 4: 98,365,618 T106I probably damaging Het
Tmem150b A C 7: 4,716,369 I184S probably null Het
Vmn1r216 A G 13: 23,099,911 I255V probably benign Het
Vps13b G A 15: 35,533,385 A868T probably damaging Het
Wdr81 C T 11: 75,450,794 D1216N probably null Het
Zfp26 T C 9: 20,438,239 Y343C possibly damaging Het
Zfp276 A T 8: 123,255,781 I95F probably damaging Het
Zfp330 T C 8: 82,764,236 E315G probably benign Het
Zfp683 C A 4: 134,054,551 P56Q probably damaging Het
Zpld1 T A 16: 55,232,283 S323C possibly damaging Het
Other mutations in Hsd3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Hsd3b2 APN 3 98711543 missense possibly damaging 0.47
IGL01102:Hsd3b2 APN 3 98711679 missense probably damaging 0.97
IGL01733:Hsd3b2 APN 3 98716485 missense probably damaging 1.00
IGL02202:Hsd3b2 APN 3 98711867 missense possibly damaging 0.85
IGL02851:Hsd3b2 APN 3 98716424 missense possibly damaging 0.84
R1737:Hsd3b2 UTSW 3 98711546 missense probably damaging 1.00
R1800:Hsd3b2 UTSW 3 98712237 missense probably damaging 1.00
R1917:Hsd3b2 UTSW 3 98712026 missense probably benign
R4797:Hsd3b2 UTSW 3 98711663 missense probably damaging 1.00
R5354:Hsd3b2 UTSW 3 98712315 missense probably benign 0.39
R5940:Hsd3b2 UTSW 3 98711971 missense probably benign 0.02
R5954:Hsd3b2 UTSW 3 98711559 missense probably benign 0.06
R6012:Hsd3b2 UTSW 3 98712017 missense probably benign
R6083:Hsd3b2 UTSW 3 98712056 missense possibly damaging 0.94
R6675:Hsd3b2 UTSW 3 98713472 missense probably benign 0.02
R7436:Hsd3b2 UTSW 3 98711796 missense probably benign 0.00
X0054:Hsd3b2 UTSW 3 98713500 missense probably damaging 1.00
Z1176:Hsd3b2 UTSW 3 98712222 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGACAGTGTGACCAAGTGG -3'
(R):5'- GCATTTATGGGGAGAGAAGTCC -3'

Sequencing Primer
(F):5'- CTCAGGAGGAAGCTCACAGTTTC -3'
(R):5'- TATGGGGAGAGAAGTCCACTCATTTC -3'
Posted On2016-09-01