Incidental Mutation 'R5412:Hnrnpl'
ID427536
Institutional Source Beutler Lab
Gene Symbol Hnrnpl
Ensembl Gene ENSMUSG00000015165
Gene Nameheterogeneous nuclear ribonucleoprotein L
SynonymsHnrpl, D830027H13Rik
MMRRC Submission 042981-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5412 (G1)
Quality Score211
Status Not validated
Chromosome7
Chromosomal Location28808541-28822266 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 28811104 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038572] [ENSMUST00000172529] [ENSMUST00000172884] [ENSMUST00000174548] [ENSMUST00000174882]
Predicted Effect unknown
Transcript: ENSMUST00000038572
AA Change: N65S
SMART Domains Protein: ENSMUSP00000049407
Gene: ENSMUSG00000015165
AA Change: N65S

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172529
SMART Domains Protein: ENSMUSP00000133932
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
Blast:RRM 1 39 9e-20 BLAST
RRM 61 131 4.75e-7 SMART
low complexity region 184 209 N/A INTRINSIC
low complexity region 226 244 N/A INTRINSIC
RRM 250 319 5.09e-7 SMART
Blast:RRM_2 369 442 6e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172841
Predicted Effect probably benign
Transcript: ENSMUST00000172884
SMART Domains Protein: ENSMUSP00000134271
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
Blast:RRM 1 39 1e-21 BLAST
SCOP:d1qm9a1 3 61 3e-3 SMART
Pfam:RRM_6 67 113 5.7e-5 PFAM
Pfam:RRM_1 70 113 1.3e-5 PFAM
Pfam:RRM_5 78 113 9.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174396
Predicted Effect unknown
Transcript: ENSMUST00000174477
AA Change: N56S
SMART Domains Protein: ENSMUSP00000134734
Gene: ENSMUSG00000015165
AA Change: N56S

DomainStartEndE-ValueType
low complexity region 4 49 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
RRM 92 161 9.8e-9 SMART
RRM 183 253 4.75e-7 SMART
low complexity region 339 368 N/A INTRINSIC
low complexity region 385 403 N/A INTRINSIC
RRM 409 478 5.09e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174548
AA Change: N65S
SMART Domains Protein: ENSMUSP00000133728
Gene: ENSMUSG00000015165
AA Change: N65S

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174755
Predicted Effect probably benign
Transcript: ENSMUST00000174882
SMART Domains Protein: ENSMUSP00000133952
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
RRM 1 61 5.18e-1 SMART
RRM 83 153 4.75e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209194
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterogeneous nuclear RNAs (hnRNAs) which include mRNA precursors and mature mRNAs are associated with specific proteins to form heterogenous ribonucleoprotein (hnRNP) complexes. Heterogeneous nuclear ribonucleoprotein L is among the proteins that are stably associated with hnRNP complexes and along with other hnRNP proteins is likely to play a major role in the formation, packaging, processing, and function of mRNA. Heterogeneous nuclear ribonucleoprotein L is present in the nucleoplasm as part of the HNRP complex. HNRP proteins have also been identified outside of the nucleoplasm. Exchange of hnRNP for mRNA-binding proteins accompanies transport of mRNA from the nucleus to the cytoplasm. Since HNRP proteins have been shown to shuttle between the nucleus and the cytoplasm, it is possible that they also have cytoplasmic functions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic letahlity after E3.5. Mice homozygous for a conditional allele activated in thymocytes exhibit decreased T cells in the periphery associated with impaired thymocyte chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,978,752 N36Y probably damaging Het
Ankfn1 T A 11: 89,505,181 E246D probably benign Het
Arid1a T C 4: 133,719,602 probably benign Het
Bbs7 A T 3: 36,599,373 D300E probably benign Het
BC025446 A T 15: 75,217,820 E59V probably damaging Het
C3 T C 17: 57,220,187 D754G probably benign Het
Ccpg1 A T 9: 73,010,306 Q240L probably damaging Het
Cdk13 G A 13: 17,766,530 P650S probably damaging Het
Celsr2 G T 3: 108,399,995 S1933Y probably damaging Het
Cep135 T A 5: 76,616,862 H562Q probably benign Het
Cyp26a1 G T 19: 37,701,182 C442F probably damaging Het
Dnah7a T C 1: 53,635,344 S425G probably benign Het
Espn C T 4: 152,128,125 V752M probably damaging Het
Glyr1 A G 16: 5,036,433 S113P possibly damaging Het
Gm11127 C T 17: 36,056,044 C369Y probably benign Het
Grk4 A T 5: 34,745,268 Y388F probably benign Het
Heca C A 10: 17,902,296 V518F probably damaging Het
Hmcn2 C T 2: 31,346,617 P391S possibly damaging Het
Hsd3b2 A G 3: 98,711,892 S246P possibly damaging Het
Ifna11 C T 4: 88,820,143 P62L probably damaging Het
Katnal2 A T 18: 77,002,435 V292D probably damaging Het
Krt16 T A 11: 100,246,767 I371F probably damaging Het
Map10 A T 8: 125,670,985 L372F probably damaging Het
Megf10 A T 18: 57,191,147 M87L probably damaging Het
Ncoa6 T C 2: 155,407,781 H1201R possibly damaging Het
Ndc80 C A 17: 71,514,231 D241Y probably damaging Het
Ndufs1 T C 1: 63,166,349 M94V possibly damaging Het
Nkx2-6 G T 14: 69,174,746 R121L probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr2 A G 7: 107,001,635 V75A probably damaging Het
Otop1 A G 5: 38,297,984 I241V probably benign Het
Panx2 C A 15: 89,068,932 P542H possibly damaging Het
Pcdha5 C A 18: 36,962,457 P673Q probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Prdx6 A T 1: 161,244,290 I102N probably damaging Het
Prkd3 T A 17: 78,954,711 I725F possibly damaging Het
Selenon T C 4: 134,542,438 N395S probably benign Het
Serpinb8 G A 1: 107,605,886 E224K probably benign Het
Serpinb9b A G 13: 33,029,513 M18V probably benign Het
Smc6 A G 12: 11,285,399 E318G possibly damaging Het
Srrt A T 5: 137,296,287 Y786N probably damaging Het
Stk36 G T 1: 74,605,456 probably null Het
Stpg1 T A 4: 135,525,475 L179Q possibly damaging Het
Stra8 G A 6: 34,930,950 M1I probably null Het
Tiam1 G T 16: 89,884,865 H408Q possibly damaging Het
Tm2d1 G A 4: 98,365,618 T106I probably damaging Het
Tmem150b A C 7: 4,716,369 I184S probably null Het
Vmn1r216 A G 13: 23,099,911 I255V probably benign Het
Vps13b G A 15: 35,533,385 A868T probably damaging Het
Wdr81 C T 11: 75,450,794 D1216N probably null Het
Zfp26 T C 9: 20,438,239 Y343C possibly damaging Het
Zfp276 A T 8: 123,255,781 I95F probably damaging Het
Zfp330 T C 8: 82,764,236 E315G probably benign Het
Zfp683 C A 4: 134,054,551 P56Q probably damaging Het
Zpld1 T A 16: 55,232,283 S323C possibly damaging Het
Other mutations in Hnrnpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Hnrnpl APN 7 28813373 missense probably damaging 1.00
IGL00783:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL00784:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL03248:Hnrnpl APN 7 28814080 missense probably benign 0.00
R0143:Hnrnpl UTSW 7 28814192 splice site probably benign
R1529:Hnrnpl UTSW 7 28813923 missense possibly damaging 0.74
R1567:Hnrnpl UTSW 7 28820183 missense possibly damaging 0.73
R3786:Hnrnpl UTSW 7 28811011 unclassified probably benign
R4837:Hnrnpl UTSW 7 28817337 missense probably benign 0.00
R6617:Hnrnpl UTSW 7 28818584 intron probably benign
R7238:Hnrnpl UTSW 7 28813975 missense
Predicted Primers PCR Primer
(F):5'- CCTATCCAATAGAAATGAACCGTG -3'
(R):5'- GGTTGTAGAAACGCGCTTG -3'

Sequencing Primer
(F):5'- TGTCCCTCCCCCAATGAGAG -3'
(R):5'- TTGCGCATAGGGACACG -3'
Posted On2016-09-01