Incidental Mutation 'R5412:Olfr2'
ID427537
Institutional Source Beutler Lab
Gene Symbol Olfr2
Ensembl Gene ENSMUSG00000070417
Gene Nameolfactory receptor 2
SynonymsMOR103-15, I7, I54, Olfr41, GA_x6K02T2PBJ9-9381439-9380456
MMRRC Submission 042981-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R5412 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106995399-107006072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107001635 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 75 (V75A)
Ref Sequence ENSEMBL: ENSMUSP00000150093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094109] [ENSMUST00000207280] [ENSMUST00000208147] [ENSMUST00000211432] [ENSMUST00000214105] [ENSMUST00000216375]
Predicted Effect probably damaging
Transcript: ENSMUST00000094109
AA Change: V75A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091656
Gene: ENSMUSG00000070417
AA Change: V75A

DomainStartEndE-ValueType
Pfam:7tm_4 31 313 9.2e-53 PFAM
Pfam:7tm_1 42 295 3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207280
AA Change: V75A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000208147
AA Change: V75A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211432
AA Change: V75A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000214105
AA Change: V75A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216375
AA Change: V75A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217764
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,978,752 N36Y probably damaging Het
Ankfn1 T A 11: 89,505,181 E246D probably benign Het
Arid1a T C 4: 133,719,602 probably benign Het
Bbs7 A T 3: 36,599,373 D300E probably benign Het
BC025446 A T 15: 75,217,820 E59V probably damaging Het
C3 T C 17: 57,220,187 D754G probably benign Het
Ccpg1 A T 9: 73,010,306 Q240L probably damaging Het
Cdk13 G A 13: 17,766,530 P650S probably damaging Het
Celsr2 G T 3: 108,399,995 S1933Y probably damaging Het
Cep135 T A 5: 76,616,862 H562Q probably benign Het
Cyp26a1 G T 19: 37,701,182 C442F probably damaging Het
Dnah7a T C 1: 53,635,344 S425G probably benign Het
Espn C T 4: 152,128,125 V752M probably damaging Het
Glyr1 A G 16: 5,036,433 S113P possibly damaging Het
Gm11127 C T 17: 36,056,044 C369Y probably benign Het
Grk4 A T 5: 34,745,268 Y388F probably benign Het
Heca C A 10: 17,902,296 V518F probably damaging Het
Hmcn2 C T 2: 31,346,617 P391S possibly damaging Het
Hnrnpl A G 7: 28,811,104 probably benign Het
Hsd3b2 A G 3: 98,711,892 S246P possibly damaging Het
Ifna11 C T 4: 88,820,143 P62L probably damaging Het
Katnal2 A T 18: 77,002,435 V292D probably damaging Het
Krt16 T A 11: 100,246,767 I371F probably damaging Het
Map10 A T 8: 125,670,985 L372F probably damaging Het
Megf10 A T 18: 57,191,147 M87L probably damaging Het
Ncoa6 T C 2: 155,407,781 H1201R possibly damaging Het
Ndc80 C A 17: 71,514,231 D241Y probably damaging Het
Ndufs1 T C 1: 63,166,349 M94V possibly damaging Het
Nkx2-6 G T 14: 69,174,746 R121L probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Otop1 A G 5: 38,297,984 I241V probably benign Het
Panx2 C A 15: 89,068,932 P542H possibly damaging Het
Pcdha5 C A 18: 36,962,457 P673Q probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Prdx6 A T 1: 161,244,290 I102N probably damaging Het
Prkd3 T A 17: 78,954,711 I725F possibly damaging Het
Selenon T C 4: 134,542,438 N395S probably benign Het
Serpinb8 G A 1: 107,605,886 E224K probably benign Het
Serpinb9b A G 13: 33,029,513 M18V probably benign Het
Smc6 A G 12: 11,285,399 E318G possibly damaging Het
Srrt A T 5: 137,296,287 Y786N probably damaging Het
Stk36 G T 1: 74,605,456 probably null Het
Stpg1 T A 4: 135,525,475 L179Q possibly damaging Het
Stra8 G A 6: 34,930,950 M1I probably null Het
Tiam1 G T 16: 89,884,865 H408Q possibly damaging Het
Tm2d1 G A 4: 98,365,618 T106I probably damaging Het
Tmem150b A C 7: 4,716,369 I184S probably null Het
Vmn1r216 A G 13: 23,099,911 I255V probably benign Het
Vps13b G A 15: 35,533,385 A868T probably damaging Het
Wdr81 C T 11: 75,450,794 D1216N probably null Het
Zfp26 T C 9: 20,438,239 Y343C possibly damaging Het
Zfp276 A T 8: 123,255,781 I95F probably damaging Het
Zfp330 T C 8: 82,764,236 E315G probably benign Het
Zfp683 C A 4: 134,054,551 P56Q probably damaging Het
Zpld1 T A 16: 55,232,283 S323C possibly damaging Het
Other mutations in Olfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Olfr2 APN 7 107001423 missense probably damaging 1.00
IGL02620:Olfr2 APN 7 107001618 nonsense probably null
IGL02942:Olfr2 APN 7 107001354 missense possibly damaging 0.88
R1171:Olfr2 UTSW 7 107001584 missense probably benign
R1956:Olfr2 UTSW 7 107001135 missense probably damaging 1.00
R2128:Olfr2 UTSW 7 107001248 missense probably damaging 1.00
R2342:Olfr2 UTSW 7 107000909 missense probably benign
R2351:Olfr2 UTSW 7 107001676 nonsense probably null
R3752:Olfr2 UTSW 7 107001475 nonsense probably null
R4197:Olfr2 UTSW 7 107001038 missense probably damaging 0.97
R4237:Olfr2 UTSW 7 107001329 missense probably damaging 1.00
R4787:Olfr2 UTSW 7 107001086 missense probably benign 0.00
R4795:Olfr2 UTSW 7 107001335 missense probably damaging 1.00
R4796:Olfr2 UTSW 7 107001335 missense probably damaging 1.00
R5268:Olfr2 UTSW 7 107000904 missense probably benign 0.00
R5474:Olfr2 UTSW 7 107001089 missense probably damaging 0.98
R5542:Olfr2 UTSW 7 107001079 missense probably damaging 1.00
R5792:Olfr2 UTSW 7 107001443 missense possibly damaging 0.61
R6149:Olfr2 UTSW 7 107001600 missense probably benign
R7552:Olfr2 UTSW 7 107001327 missense probably benign
R7838:Olfr2 UTSW 7 107001307 nonsense probably null
R7921:Olfr2 UTSW 7 107001307 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCCACATAGCGGTCATAG -3'
(R):5'- CCAAGCTAGATTCTTGCTGCTG -3'

Sequencing Primer
(F):5'- CACATAGCGGTCATAGGCCATG -3'
(R):5'- ACCTTGGTCTATCTCTTGAACAAGAC -3'
Posted On2016-09-01