Incidental Mutation 'R5412:Cdk13'
ID427550
Institutional Source Beutler Lab
Gene Symbol Cdk13
Ensembl Gene ENSMUSG00000041297
Gene Namecyclin-dependent kinase 13
Synonyms2310015O17Rik, Cdc2l5
MMRRC Submission 042981-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5412 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location17710315-17805097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17766530 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 650 (P650S)
Ref Sequence ENSEMBL: ENSMUSP00000152820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042365] [ENSMUST00000222800] [ENSMUST00000223490]
Predicted Effect probably damaging
Transcript: ENSMUST00000042365
AA Change: P650S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036013
Gene: ENSMUSG00000041297
AA Change: P650S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 32 86 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 130 139 N/A INTRINSIC
low complexity region 160 187 N/A INTRINSIC
low complexity region 189 225 N/A INTRINSIC
low complexity region 238 272 N/A INTRINSIC
low complexity region 337 377 N/A INTRINSIC
low complexity region 384 402 N/A INTRINSIC
low complexity region 405 442 N/A INTRINSIC
low complexity region 450 490 N/A INTRINSIC
internal_repeat_1 553 599 6.15e-5 PROSPERO
low complexity region 607 617 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 645 661 N/A INTRINSIC
S_TKc 705 998 7.25e-94 SMART
low complexity region 1173 1184 N/A INTRINSIC
internal_repeat_1 1190 1236 6.15e-5 PROSPERO
low complexity region 1248 1273 N/A INTRINSIC
low complexity region 1299 1311 N/A INTRINSIC
low complexity region 1355 1360 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222800
AA Change: P36S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222848
Predicted Effect probably damaging
Transcript: ENSMUST00000223490
AA Change: P650S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent serine/threonine protein kinase family. Members of this family are well known for their essential roles as master switches in cell cycle control. The exact function of this protein has not yet been determined, but it may play a role in mRNA processing and may be involved in regulation of hematopoiesis. Alternatively spliced transcript variants have been described.[provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,978,752 N36Y probably damaging Het
Ankfn1 T A 11: 89,505,181 E246D probably benign Het
Arid1a T C 4: 133,719,602 probably benign Het
Bbs7 A T 3: 36,599,373 D300E probably benign Het
BC025446 A T 15: 75,217,820 E59V probably damaging Het
C3 T C 17: 57,220,187 D754G probably benign Het
Ccpg1 A T 9: 73,010,306 Q240L probably damaging Het
Celsr2 G T 3: 108,399,995 S1933Y probably damaging Het
Cep135 T A 5: 76,616,862 H562Q probably benign Het
Cyp26a1 G T 19: 37,701,182 C442F probably damaging Het
Dnah7a T C 1: 53,635,344 S425G probably benign Het
Espn C T 4: 152,128,125 V752M probably damaging Het
Glyr1 A G 16: 5,036,433 S113P possibly damaging Het
Gm11127 C T 17: 36,056,044 C369Y probably benign Het
Grk4 A T 5: 34,745,268 Y388F probably benign Het
Heca C A 10: 17,902,296 V518F probably damaging Het
Hmcn2 C T 2: 31,346,617 P391S possibly damaging Het
Hnrnpl A G 7: 28,811,104 probably benign Het
Hsd3b2 A G 3: 98,711,892 S246P possibly damaging Het
Ifna11 C T 4: 88,820,143 P62L probably damaging Het
Katnal2 A T 18: 77,002,435 V292D probably damaging Het
Krt16 T A 11: 100,246,767 I371F probably damaging Het
Map10 A T 8: 125,670,985 L372F probably damaging Het
Megf10 A T 18: 57,191,147 M87L probably damaging Het
Ncoa6 T C 2: 155,407,781 H1201R possibly damaging Het
Ndc80 C A 17: 71,514,231 D241Y probably damaging Het
Ndufs1 T C 1: 63,166,349 M94V possibly damaging Het
Nkx2-6 G T 14: 69,174,746 R121L probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr2 A G 7: 107,001,635 V75A probably damaging Het
Otop1 A G 5: 38,297,984 I241V probably benign Het
Panx2 C A 15: 89,068,932 P542H possibly damaging Het
Pcdha5 C A 18: 36,962,457 P673Q probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Prdx6 A T 1: 161,244,290 I102N probably damaging Het
Prkd3 T A 17: 78,954,711 I725F possibly damaging Het
Selenon T C 4: 134,542,438 N395S probably benign Het
Serpinb8 G A 1: 107,605,886 E224K probably benign Het
Serpinb9b A G 13: 33,029,513 M18V probably benign Het
Smc6 A G 12: 11,285,399 E318G possibly damaging Het
Srrt A T 5: 137,296,287 Y786N probably damaging Het
Stk36 G T 1: 74,605,456 probably null Het
Stpg1 T A 4: 135,525,475 L179Q possibly damaging Het
Stra8 G A 6: 34,930,950 M1I probably null Het
Tiam1 G T 16: 89,884,865 H408Q possibly damaging Het
Tm2d1 G A 4: 98,365,618 T106I probably damaging Het
Tmem150b A C 7: 4,716,369 I184S probably null Het
Vmn1r216 A G 13: 23,099,911 I255V probably benign Het
Vps13b G A 15: 35,533,385 A868T probably damaging Het
Wdr81 C T 11: 75,450,794 D1216N probably null Het
Zfp26 T C 9: 20,438,239 Y343C possibly damaging Het
Zfp276 A T 8: 123,255,781 I95F probably damaging Het
Zfp330 T C 8: 82,764,236 E315G probably benign Het
Zfp683 C A 4: 134,054,551 P56Q probably damaging Het
Zpld1 T A 16: 55,232,283 S323C possibly damaging Het
Other mutations in Cdk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Cdk13 APN 13 17721098 missense possibly damaging 0.88
IGL00800:Cdk13 APN 13 17728142 missense probably damaging 1.00
IGL02186:Cdk13 APN 13 17772527 missense probably benign 0.02
IGL02447:Cdk13 APN 13 17772416 missense probably benign 0.10
IGL02494:Cdk13 APN 13 17739125 nonsense probably null
IGL02542:Cdk13 APN 13 17728178 missense probably damaging 0.99
IGL02602:Cdk13 APN 13 17727160 missense probably damaging 0.99
Vortex UTSW 13 17739154 missense probably damaging 1.00
Whirlpool UTSW 13 17772403 missense possibly damaging 0.92
R0115:Cdk13 UTSW 13 17719494 missense probably damaging 0.99
R0421:Cdk13 UTSW 13 17763170 missense probably damaging 0.99
R0481:Cdk13 UTSW 13 17719494 missense probably damaging 0.99
R0681:Cdk13 UTSW 13 17721297 splice site probably benign
R1432:Cdk13 UTSW 13 17718416 missense probably damaging 1.00
R2013:Cdk13 UTSW 13 17739163 nonsense probably null
R2221:Cdk13 UTSW 13 17719535 missense probably damaging 0.99
R2332:Cdk13 UTSW 13 17718695 missense probably damaging 1.00
R2389:Cdk13 UTSW 13 17751776 missense probably damaging 1.00
R4546:Cdk13 UTSW 13 17766574 missense probably damaging 0.98
R4753:Cdk13 UTSW 13 17763248 missense probably damaging 1.00
R4855:Cdk13 UTSW 13 17721283 missense probably damaging 1.00
R4856:Cdk13 UTSW 13 17719734 missense probably benign
R4861:Cdk13 UTSW 13 17766586 missense probably damaging 1.00
R4861:Cdk13 UTSW 13 17766586 missense probably damaging 1.00
R4886:Cdk13 UTSW 13 17719734 missense probably benign
R4909:Cdk13 UTSW 13 17772403 missense possibly damaging 0.92
R5152:Cdk13 UTSW 13 17718525 missense probably benign 0.13
R5308:Cdk13 UTSW 13 17772313 missense probably damaging 0.98
R5350:Cdk13 UTSW 13 17803930 unclassified probably benign
R5493:Cdk13 UTSW 13 17803562 unclassified probably benign
R5719:Cdk13 UTSW 13 17719655 missense probably damaging 0.98
R6052:Cdk13 UTSW 13 17721215 missense probably damaging 1.00
R6349:Cdk13 UTSW 13 17751719 missense probably damaging 1.00
R6415:Cdk13 UTSW 13 17739154 missense probably damaging 1.00
R7665:Cdk13 UTSW 13 17772553 missense possibly damaging 0.78
R7666:Cdk13 UTSW 13 17772576 start gained probably benign
R7764:Cdk13 UTSW 13 17721305 splice site probably null
RF009:Cdk13 UTSW 13 17803744 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTTCAGAACTCTAAACCAACCTG -3'
(R):5'- TGGACTTGAAGTATGACATATGCC -3'

Sequencing Primer
(F):5'- GTCAACCTAAGTGCCAGT -3'
(R):5'- CTTGAAGTATGACATATGCCTTTGC -3'
Posted On2016-09-01