Incidental Mutation 'R5412:Glyr1'
ID427558
Institutional Source Beutler Lab
Gene Symbol Glyr1
Ensembl Gene ENSMUSG00000022536
Gene Nameglyoxylate reductase 1 homolog (Arabidopsis)
Synonyms3930401K13Rik, Npac, 2810419J22Rik
MMRRC Submission 042981-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R5412 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location5013909-5049863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5036433 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 113 (S113P)
Ref Sequence ENSEMBL: ENSMUSP00000111510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023189] [ENSMUST00000115844]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023189
AA Change: S113P

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023189
Gene: ENSMUSG00000022536
AA Change: S113P

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.4e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 422 1.2e-36 PFAM
Pfam:F420_oxidored 268 355 2e-6 PFAM
Pfam:NAD_binding_11 423 544 2.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115844
AA Change: S113P

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111510
Gene: ENSMUSG00000022536
AA Change: S113P

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.8e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 428 2.6e-41 PFAM
Pfam:F420_oxidored 268 361 3.2e-9 PFAM
Pfam:NAD_binding_11 429 550 3.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231132
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,978,752 N36Y probably damaging Het
Ankfn1 T A 11: 89,505,181 E246D probably benign Het
Arid1a T C 4: 133,719,602 probably benign Het
Bbs7 A T 3: 36,599,373 D300E probably benign Het
BC025446 A T 15: 75,217,820 E59V probably damaging Het
C3 T C 17: 57,220,187 D754G probably benign Het
Ccpg1 A T 9: 73,010,306 Q240L probably damaging Het
Cdk13 G A 13: 17,766,530 P650S probably damaging Het
Celsr2 G T 3: 108,399,995 S1933Y probably damaging Het
Cep135 T A 5: 76,616,862 H562Q probably benign Het
Cyp26a1 G T 19: 37,701,182 C442F probably damaging Het
Dnah7a T C 1: 53,635,344 S425G probably benign Het
Espn C T 4: 152,128,125 V752M probably damaging Het
Gm11127 C T 17: 36,056,044 C369Y probably benign Het
Grk4 A T 5: 34,745,268 Y388F probably benign Het
Heca C A 10: 17,902,296 V518F probably damaging Het
Hmcn2 C T 2: 31,346,617 P391S possibly damaging Het
Hnrnpl A G 7: 28,811,104 probably benign Het
Hsd3b2 A G 3: 98,711,892 S246P possibly damaging Het
Ifna11 C T 4: 88,820,143 P62L probably damaging Het
Katnal2 A T 18: 77,002,435 V292D probably damaging Het
Krt16 T A 11: 100,246,767 I371F probably damaging Het
Map10 A T 8: 125,670,985 L372F probably damaging Het
Megf10 A T 18: 57,191,147 M87L probably damaging Het
Ncoa6 T C 2: 155,407,781 H1201R possibly damaging Het
Ndc80 C A 17: 71,514,231 D241Y probably damaging Het
Ndufs1 T C 1: 63,166,349 M94V possibly damaging Het
Nkx2-6 G T 14: 69,174,746 R121L probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr2 A G 7: 107,001,635 V75A probably damaging Het
Otop1 A G 5: 38,297,984 I241V probably benign Het
Panx2 C A 15: 89,068,932 P542H possibly damaging Het
Pcdha5 C A 18: 36,962,457 P673Q probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Prdx6 A T 1: 161,244,290 I102N probably damaging Het
Prkd3 T A 17: 78,954,711 I725F possibly damaging Het
Selenon T C 4: 134,542,438 N395S probably benign Het
Serpinb8 G A 1: 107,605,886 E224K probably benign Het
Serpinb9b A G 13: 33,029,513 M18V probably benign Het
Smc6 A G 12: 11,285,399 E318G possibly damaging Het
Srrt A T 5: 137,296,287 Y786N probably damaging Het
Stk36 G T 1: 74,605,456 probably null Het
Stpg1 T A 4: 135,525,475 L179Q possibly damaging Het
Stra8 G A 6: 34,930,950 M1I probably null Het
Tiam1 G T 16: 89,884,865 H408Q possibly damaging Het
Tm2d1 G A 4: 98,365,618 T106I probably damaging Het
Tmem150b A C 7: 4,716,369 I184S probably null Het
Vmn1r216 A G 13: 23,099,911 I255V probably benign Het
Vps13b G A 15: 35,533,385 A868T probably damaging Het
Wdr81 C T 11: 75,450,794 D1216N probably null Het
Zfp26 T C 9: 20,438,239 Y343C possibly damaging Het
Zfp276 A T 8: 123,255,781 I95F probably damaging Het
Zfp330 T C 8: 82,764,236 E315G probably benign Het
Zfp683 C A 4: 134,054,551 P56Q probably damaging Het
Zpld1 T A 16: 55,232,283 S323C possibly damaging Het
Other mutations in Glyr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Glyr1 APN 16 5020288 missense probably benign
IGL02332:Glyr1 APN 16 5018953 missense probably damaging 1.00
IGL02407:Glyr1 APN 16 5036948 missense probably benign 0.01
IGL02429:Glyr1 APN 16 5019376 missense probably benign 0.28
IGL03255:Glyr1 APN 16 5048757 unclassified probably null
R0020:Glyr1 UTSW 16 5037049 missense probably damaging 1.00
R0309:Glyr1 UTSW 16 5031972 missense probably damaging 0.98
R0694:Glyr1 UTSW 16 5026560 missense probably damaging 0.99
R0971:Glyr1 UTSW 16 5021345 frame shift probably null
R1347:Glyr1 UTSW 16 5021339 missense probably damaging 1.00
R1347:Glyr1 UTSW 16 5021339 missense probably damaging 1.00
R1382:Glyr1 UTSW 16 5021345 frame shift probably null
R1383:Glyr1 UTSW 16 5021345 frame shift probably null
R2137:Glyr1 UTSW 16 5018482 missense probably benign 0.01
R2254:Glyr1 UTSW 16 5019013 missense probably benign 0.01
R3913:Glyr1 UTSW 16 5031913 missense probably damaging 1.00
R4112:Glyr1 UTSW 16 5018486 missense possibly damaging 0.83
R4629:Glyr1 UTSW 16 5037043 missense possibly damaging 0.70
R4795:Glyr1 UTSW 16 5047758 missense probably benign 0.40
R5112:Glyr1 UTSW 16 5018876 nonsense probably null
R5757:Glyr1 UTSW 16 5018992 missense probably benign 0.30
R6425:Glyr1 UTSW 16 5036486 splice site probably null
R7646:Glyr1 UTSW 16 5018497 missense probably damaging 1.00
Z1177:Glyr1 UTSW 16 5031973 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CACTAGTCCCAGAAGCTACG -3'
(R):5'- TCTCAGGGTGGCTATGAAGAC -3'

Sequencing Primer
(F):5'- AAGACAAACCTTCTCATCCTTTGGG -3'
(R):5'- CTCAGGGTGGCTATGAAGACAGTTC -3'
Posted On2016-09-01