Incidental Mutation 'R5413:Pcsk2'
ID427571
Institutional Source Beutler Lab
Gene Symbol Pcsk2
Ensembl Gene ENSMUSG00000027419
Gene Nameproprotein convertase subtilisin/kexin type 2
SynonymsPhpp-2, SPC2, Nec2, PC2, Nec-2, prohormone convertase 2, 6330411F23Rik
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location143546156-143816285 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 143696700 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028905]
Predicted Effect probably null
Transcript: ENSMUST00000028905
SMART Domains Protein: ENSMUSP00000028905
Gene: ENSMUSG00000027419

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:S8_pro-domain 32 108 2.9e-21 PFAM
Pfam:Peptidase_S8 157 444 5e-44 PFAM
Pfam:P_proprotein 503 590 4.3e-28 PFAM
low complexity region 617 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The protein undergoes an initial autocatalytic processing event and interacts with a neuroendocrine secretory protein in the ER, exits the ER and sorts to secretory granules, where it is cleaved and catalytically activated during intracellular transport. The encoded protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Single nucleotide polymorphisms in this gene may increase susceptibility to myocardial infarction and type 2 diabetes. This gene may also play a role in tumor development and progression. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in the maturation of peptide hormones leading to reduced female fertility, increased blood pressure on a high salt diet, and abnormal glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Pcsk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Pcsk2 APN 2 143793239 missense probably damaging 1.00
IGL01609:Pcsk2 APN 2 143801158 missense possibly damaging 0.88
IGL01690:Pcsk2 APN 2 143687570 missense probably benign
IGL01833:Pcsk2 APN 2 143687580 missense possibly damaging 0.62
IGL01962:Pcsk2 APN 2 143813632 nonsense probably null
IGL02219:Pcsk2 APN 2 143793125 missense probably damaging 1.00
IGL02572:Pcsk2 APN 2 143690342 missense probably damaging 1.00
IGL02752:Pcsk2 APN 2 143773945 missense probably benign 0.09
P0035:Pcsk2 UTSW 2 143795951 missense probably damaging 1.00
R0092:Pcsk2 UTSW 2 143801024 missense probably damaging 1.00
R1424:Pcsk2 UTSW 2 143573428 splice site probably benign
R1470:Pcsk2 UTSW 2 143546518 nonsense probably null
R1470:Pcsk2 UTSW 2 143546518 nonsense probably null
R1832:Pcsk2 UTSW 2 143793269 missense probably damaging 1.00
R1993:Pcsk2 UTSW 2 143687619 missense probably benign 0.00
R4615:Pcsk2 UTSW 2 143795969 missense probably damaging 1.00
R4783:Pcsk2 UTSW 2 143687679 critical splice donor site probably null
R4796:Pcsk2 UTSW 2 143813425 missense probably benign 0.16
R4827:Pcsk2 UTSW 2 143801179 nonsense probably null
R5357:Pcsk2 UTSW 2 143573464 missense probably benign 0.00
R5440:Pcsk2 UTSW 2 143546543 missense probably benign 0.22
R5546:Pcsk2 UTSW 2 143546560 missense probably benign 0.00
R5605:Pcsk2 UTSW 2 143749245 intron probably benign
R5821:Pcsk2 UTSW 2 143749115 splice site probably null
R5905:Pcsk2 UTSW 2 143749140 missense probably damaging 0.98
R6120:Pcsk2 UTSW 2 143801111 missense probably damaging 1.00
R6135:Pcsk2 UTSW 2 143573540 missense possibly damaging 0.63
R6657:Pcsk2 UTSW 2 143690366 missense probably damaging 1.00
R6925:Pcsk2 UTSW 2 143813747 missense probably damaging 1.00
R7223:Pcsk2 UTSW 2 143690333 missense possibly damaging 0.95
R7289:Pcsk2 UTSW 2 143690423 missense probably damaging 1.00
R8043:Pcsk2 UTSW 2 143813530 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGAAGTGATGCAGCCCTC -3'
(R):5'- CGTGAACATCTGAGTAGCACAC -3'

Sequencing Primer
(F):5'- GGGTTCAGGGTAAGCACTGC -3'
(R):5'- TCTGAGTAGCACACACAGATGCG -3'
Posted On2016-09-01