Incidental Mutation 'R5413:Clk2'
ID427573
Institutional Source Beutler Lab
Gene Symbol Clk2
Ensembl Gene ENSMUSG00000068917
Gene NameCDC-like kinase 2
Synonyms
MMRRC Submission 042982-MU
Accession Numbers

Genbank: NM_007712, NM_001163432

Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89164795-89176921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89173478 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 258 (N258S)
Ref Sequence ENSEMBL: ENSMUSP00000113861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029684] [ENSMUST00000090927] [ENSMUST00000098941] [ENSMUST00000120697] [ENSMUST00000121212] [ENSMUST00000121931] [ENSMUST00000128318] [ENSMUST00000148265]
Predicted Effect probably benign
Transcript: ENSMUST00000029684
SMART Domains Protein: ENSMUSP00000029684
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 310 1.5e-76 PFAM
low complexity region 329 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090927
AA Change: N256S

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088445
Gene: ENSMUSG00000068917
AA Change: N256S

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 72 N/A INTRINSIC
low complexity region 105 137 N/A INTRINSIC
S_TKc 161 477 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098941
SMART Domains Protein: ENSMUSP00000096540
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 229 5.5e-46 PFAM
Pfam:SCAMP 227 276 2.2e-11 PFAM
low complexity region 295 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120697
SMART Domains Protein: ENSMUSP00000112846
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 50 70 N/A INTRINSIC
coiled coil region 90 128 N/A INTRINSIC
Pfam:SCAMP 135 310 1.1e-67 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121212
AA Change: N257S

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113390
Gene: ENSMUSG00000068917
AA Change: N257S

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
S_TKc 162 478 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121931
AA Change: N258S

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113861
Gene: ENSMUSG00000068917
AA Change: N258S

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 142 N/A INTRINSIC
S_TKc 163 479 1.46e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124291
Predicted Effect probably benign
Transcript: ENSMUST00000128318
SMART Domains Protein: ENSMUSP00000115761
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 103 133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139221
Predicted Effect probably benign
Transcript: ENSMUST00000148265
SMART Domains Protein: ENSMUSP00000122634
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
Pfam:Pkinase 162 249 7.4e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual specificity protein kinase that phosphorylates serine/threonine and tyrosine-containing substrates. Activity of this protein regulates serine- and arginine-rich (SR) proteins of the spliceosomal complex, thereby influencing alternative transcript splicing. Chromosomal translocations have been characterized between this locus and the PAFAH1B3 (platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)) gene on chromosome 19, resulting in the production of a fusion protein. Note that this gene is distinct from the TELO2 gene (GeneID:9894), which shares the CLK2 alias, but encodes a protein that is involved in telomere length regulation. There is a pseudogene for this gene on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated in the liver exhibit decreased hepatic fatty acid oxidation and ketogenesis. [provided by MGI curators]
Allele List at MGI

 All alleles(12) : Targeted, other(1) Gene trapped(11)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Clk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Clk2 APN 3 89175422 missense probably damaging 0.99
IGL01152:Clk2 APN 3 89176511 missense probably damaging 0.99
IGL02342:Clk2 APN 3 89175691 missense probably benign 0.00
IGL02387:Clk2 APN 3 89176391 unclassified probably benign
IGL02553:Clk2 APN 3 89175713 missense probably damaging 1.00
IGL02861:Clk2 APN 3 89173399 missense probably damaging 0.99
3-1:Clk2 UTSW 3 89170348 missense probably damaging 0.98
R1511:Clk2 UTSW 3 89168703 missense probably damaging 1.00
R1892:Clk2 UTSW 3 89175195 missense possibly damaging 0.48
R3796:Clk2 UTSW 3 89175689 missense probably benign
R3844:Clk2 UTSW 3 89170403 missense probably benign 0.06
R4737:Clk2 UTSW 3 89168709 missense probably benign 0.44
R5138:Clk2 UTSW 3 89175499 unclassified probably benign
R5447:Clk2 UTSW 3 89167191 missense possibly damaging 0.92
R5538:Clk2 UTSW 3 89175655 missense probably damaging 0.99
R6128:Clk2 UTSW 3 89174224 missense probably damaging 1.00
R7346:Clk2 UTSW 3 89173545 critical splice donor site probably null
R7578:Clk2 UTSW 3 89176500 missense probably benign
R7762:Clk2 UTSW 3 89167191 missense probably benign 0.13
R7894:Clk2 UTSW 3 89168894 missense possibly damaging 0.95
R8248:Clk2 UTSW 3 89173504 missense probably damaging 1.00
R8295:Clk2 UTSW 3 89173459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATACAGACTTTCATTTTGGTGGG -3'
(R):5'- CAGTCAAGGTGGTAAGTCGG -3'

Sequencing Primer
(F):5'- GGTGCTGGGTTTTGGGAACTTATTAG -3'
(R):5'- TGCCATGACAGCAGCAG -3'
Posted On2016-09-01