Incidental Mutation 'R5413:Dpy19l4'
ID427574
Institutional Source Beutler Lab
Gene Symbol Dpy19l4
Ensembl Gene ENSMUSG00000045205
Gene Namedpy-19-like 4 (C. elegans)
SynonymsNarg3, LOC381510
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location11261315-11322137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11289700 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 195 (L195P)
Ref Sequence ENSEMBL: ENSMUSP00000115537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084892] [ENSMUST00000128024] [ENSMUST00000139385] [ENSMUST00000142005]
Predicted Effect probably damaging
Transcript: ENSMUST00000084892
AA Change: L381P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081954
Gene: ENSMUSG00000045205
AA Change: L381P

DomainStartEndE-ValueType
Pfam:Dpy19 59 714 3e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128024
AA Change: L337P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122823
Gene: ENSMUSG00000045205
AA Change: L337P

DomainStartEndE-ValueType
Pfam:Dpy19 58 293 1e-89 PFAM
Pfam:Dpy19 291 524 4.8e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139385
AA Change: L195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115537
Gene: ENSMUSG00000045205
AA Change: L195P

DomainStartEndE-ValueType
Pfam:Dpy19 1 258 3.2e-71 PFAM
Pfam:Dpy19 254 488 7e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142005
SMART Domains Protein: ENSMUSP00000119923
Gene: ENSMUSG00000045205

DomainStartEndE-ValueType
Pfam:Dpy19 58 253 6.9e-77 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Dpy19l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dpy19l4 APN 4 11290411 missense probably benign 0.00
IGL01402:Dpy19l4 APN 4 11273006 critical splice donor site probably null
IGL01404:Dpy19l4 APN 4 11273006 critical splice donor site probably null
IGL01643:Dpy19l4 APN 4 11290184 splice site probably benign
IGL01758:Dpy19l4 APN 4 11265846 missense probably damaging 1.00
IGL01896:Dpy19l4 APN 4 11267752 missense possibly damaging 0.81
IGL02222:Dpy19l4 APN 4 11281116 missense possibly damaging 0.93
IGL02314:Dpy19l4 APN 4 11267720 missense possibly damaging 0.50
IGL02422:Dpy19l4 APN 4 11265803 missense possibly damaging 0.95
IGL02565:Dpy19l4 APN 4 11309440 missense probably benign 0.14
IGL03121:Dpy19l4 APN 4 11303334 missense probably damaging 1.00
IGL03357:Dpy19l4 APN 4 11267615 missense probably damaging 1.00
IGL03368:Dpy19l4 APN 4 11290253 missense possibly damaging 0.53
R0003:Dpy19l4 UTSW 4 11267619 missense probably damaging 1.00
R0481:Dpy19l4 UTSW 4 11272993 splice site probably benign
R0506:Dpy19l4 UTSW 4 11289715 missense probably benign 0.07
R1114:Dpy19l4 UTSW 4 11287643 splice site probably benign
R1332:Dpy19l4 UTSW 4 11276901 missense probably damaging 1.00
R1336:Dpy19l4 UTSW 4 11276901 missense probably damaging 1.00
R1355:Dpy19l4 UTSW 4 11303371 nonsense probably null
R1421:Dpy19l4 UTSW 4 11304011 missense probably benign 0.09
R1422:Dpy19l4 UTSW 4 11317168 missense possibly damaging 0.88
R1465:Dpy19l4 UTSW 4 11296034 missense probably damaging 1.00
R1465:Dpy19l4 UTSW 4 11296034 missense probably damaging 1.00
R1766:Dpy19l4 UTSW 4 11303360 missense probably damaging 1.00
R1803:Dpy19l4 UTSW 4 11281020 missense possibly damaging 0.81
R2090:Dpy19l4 UTSW 4 11304344 missense probably benign 0.34
R2324:Dpy19l4 UTSW 4 11276857 unclassified probably benign
R2446:Dpy19l4 UTSW 4 11304143 splice site probably null
R3769:Dpy19l4 UTSW 4 11276868 splice site probably null
R4151:Dpy19l4 UTSW 4 11309485 missense possibly damaging 0.89
R4472:Dpy19l4 UTSW 4 11304053 missense possibly damaging 0.91
R4609:Dpy19l4 UTSW 4 11295999 nonsense probably null
R4708:Dpy19l4 UTSW 4 11277970 missense probably benign 0.00
R4722:Dpy19l4 UTSW 4 11290521 missense possibly damaging 0.84
R4997:Dpy19l4 UTSW 4 11287493 missense probably benign 0.01
R5085:Dpy19l4 UTSW 4 11265943 critical splice acceptor site probably null
R5088:Dpy19l4 UTSW 4 11303357 missense probably damaging 1.00
R5288:Dpy19l4 UTSW 4 11289721 missense probably damaging 1.00
R5288:Dpy19l4 UTSW 4 11304014 missense probably damaging 1.00
R5758:Dpy19l4 UTSW 4 11276886 missense probably damaging 1.00
R6024:Dpy19l4 UTSW 4 11276876 missense probably damaging 1.00
R6312:Dpy19l4 UTSW 4 11289671 nonsense probably null
R6339:Dpy19l4 UTSW 4 11285111 missense probably damaging 0.98
R7055:Dpy19l4 UTSW 4 11290291 critical splice acceptor site probably null
R7359:Dpy19l4 UTSW 4 11273125 missense probably benign 0.00
R7525:Dpy19l4 UTSW 4 11317160 nonsense probably null
R7579:Dpy19l4 UTSW 4 11265909 missense probably benign 0.39
R7913:Dpy19l4 UTSW 4 11265859 nonsense probably null
R8047:Dpy19l4 UTSW 4 11317139 missense probably benign 0.00
R8049:Dpy19l4 UTSW 4 11303982 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGCCAATAATCCACAGGGCC -3'
(R):5'- GCAAACTGTGTGCTACTTAATTCAC -3'

Sequencing Primer
(F):5'- TAATCCACAGGGCCTTGAAG -3'
(R):5'- ATCAGGCTGTATTTTCTATCATTGG -3'
Posted On2016-09-01