Incidental Mutation 'R5413:Angptl3'
ID427577
Institutional Source Beutler Lab
Gene Symbol Angptl3
Ensembl Gene ENSMUSG00000028553
Gene Nameangiopoietin-like 3
Synonymshypl
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location99030954-99046111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99031022 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 6 (L6F)
Ref Sequence ENSEMBL: ENSMUSP00000030280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030280] [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
Predicted Effect probably benign
Transcript: ENSMUST00000030280
AA Change: L6F

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030280
Gene: ENSMUSG00000028553
AA Change: L6F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
Blast:FBG 195 240 6e-8 BLAST
FBG 241 454 1.5e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030286
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075836
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125546
Predicted Effect probably benign
Transcript: ENSMUST00000127417
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136091
Predicted Effect probably benign
Transcript: ENSMUST00000205650
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the angiopoietin-like family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may inhibit triglyceride metabolism. Homozygous knockout mice for this gene exhibit reduced plasma lipid concentrations, including reduced plasma triglyceride concentrations, and enhanced activity of enzymes involved in triglyceride metabolism. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a disruption in this gene display decreased plasma cholesterol and triglyceride levels. A spontaneous mutation results in a similar phenotype except that there is also a reduction in fat pad weight and decreased free fatty acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Angptl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Angptl3 APN 4 99034840 missense probably damaging 0.99
IGL01859:Angptl3 APN 4 99037432 nonsense probably null
IGL02126:Angptl3 APN 4 99031501 critical splice donor site probably null
IGL02134:Angptl3 APN 4 99031112 missense probably damaging 1.00
IGL02573:Angptl3 APN 4 99037934 missense probably damaging 1.00
IGL02756:Angptl3 APN 4 99031162 missense probably damaging 1.00
IGL03369:Angptl3 APN 4 99034820 intron probably benign
R0309:Angptl3 UTSW 4 99034469 missense probably benign 0.32
R0549:Angptl3 UTSW 4 99031455 missense probably benign 0.00
R0675:Angptl3 UTSW 4 99033262 missense probably benign 0.02
R1465:Angptl3 UTSW 4 99037520 missense probably benign 0.01
R1465:Angptl3 UTSW 4 99037520 missense probably benign 0.01
R1738:Angptl3 UTSW 4 99033262 missense probably benign 0.02
R2007:Angptl3 UTSW 4 99037397 missense probably damaging 0.99
R2656:Angptl3 UTSW 4 99037964 missense probably benign 0.01
R3436:Angptl3 UTSW 4 99033303 missense probably benign 0.24
R3437:Angptl3 UTSW 4 99033303 missense probably benign 0.24
R3615:Angptl3 UTSW 4 99034465 missense probably benign 0.06
R3616:Angptl3 UTSW 4 99034465 missense probably benign 0.06
R4161:Angptl3 UTSW 4 99031491 missense probably damaging 0.99
R4534:Angptl3 UTSW 4 99037995 missense possibly damaging 0.73
R4615:Angptl3 UTSW 4 99031361 missense probably benign 0.03
R4835:Angptl3 UTSW 4 99037412 missense probably benign 0.36
R5308:Angptl3 UTSW 4 99034486 missense probably benign 0.33
R5668:Angptl3 UTSW 4 99032084 critical splice acceptor site probably null
R5906:Angptl3 UTSW 4 99037567 missense probably benign 0.07
R6520:Angptl3 UTSW 4 99037848 missense probably benign 0.35
R6544:Angptl3 UTSW 4 99031438 missense probably damaging 1.00
R6762:Angptl3 UTSW 4 99037417 missense possibly damaging 0.91
R7889:Angptl3 UTSW 4 99031071 missense probably benign 0.00
R8305:Angptl3 UTSW 4 99031311 missense probably damaging 1.00
Z1088:Angptl3 UTSW 4 99034520 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAAGTTAGCACAGCTTAATGG -3'
(R):5'- TCTTCCAGCAGACTCTCAAGC -3'

Sequencing Primer
(F):5'- GCACAGCTTAATGGTTAACTCC -3'
(R):5'- TCAAGCTTTGAGTTCAGTTCTACTG -3'
Posted On2016-09-01