Incidental Mutation 'R5413:Piwil1'
ID427583
Institutional Source Beutler Lab
Gene Symbol Piwil1
Ensembl Gene ENSMUSG00000029423
Gene Namepiwi-like RNA-mediated gene silencing 1
SynonymsMIWI
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location128702524-128755474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128743880 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 290 (V290I)
Ref Sequence ENSEMBL: ENSMUSP00000142807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086056] [ENSMUST00000195959] [ENSMUST00000200192]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086056
AA Change: V280I

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083222
Gene: ENSMUSG00000029423
AA Change: V280I

DomainStartEndE-ValueType
GAGE 1 113 9.14e-25 SMART
Pfam:ArgoL1 228 276 4.6e-8 PFAM
PAZ 278 416 1.04e-76 SMART
Piwi 556 848 6.45e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195959
AA Change: V280I

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142386
Gene: ENSMUSG00000029423
AA Change: V280I

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
PAZ 278 416 1.04e-76 SMART
Piwi 556 831 4.99e-111 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200192
AA Change: V290I

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142807
Gene: ENSMUSG00000029423
AA Change: V290I

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
low complexity region 57 68 N/A INTRINSIC
Blast:PAZ 214 280 5e-23 BLAST
PAZ 288 426 8e-81 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIWI subfamily of Argonaute proteins, evolutionarily conserved proteins containing both PAZ and Piwi motifs that play important roles in stem cell self-renewal, RNA silencing, and translational regulation in diverse organisms. The encoded protein may play a role as an intrinsic regulator of the self-renewal capacity of germline and hematopoietic stem cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male sterility due to a block in spermatogenesis beginning at the round spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Piwil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Piwil1 APN 5 128749973 missense possibly damaging 0.95
IGL01783:Piwil1 APN 5 128743826 missense probably benign 0.29
IGL01992:Piwil1 APN 5 128747332 missense probably null 1.00
IGL02079:Piwil1 APN 5 128742003 missense possibly damaging 0.89
IGL02212:Piwil1 APN 5 128750270 missense possibly damaging 0.90
IGL03133:Piwil1 APN 5 128742029 missense probably benign
IGL03352:Piwil1 APN 5 128751072 missense probably benign 0.29
R0032:Piwil1 UTSW 5 128743280 missense probably benign 0.00
R0032:Piwil1 UTSW 5 128743280 missense probably benign 0.00
R0139:Piwil1 UTSW 5 128747323 missense probably damaging 1.00
R0667:Piwil1 UTSW 5 128741478 splice site probably null
R0691:Piwil1 UTSW 5 128743307 missense probably null 1.00
R1146:Piwil1 UTSW 5 128747893 missense probably benign
R1146:Piwil1 UTSW 5 128747893 missense probably benign
R1854:Piwil1 UTSW 5 128747839 nonsense probably null
R2126:Piwil1 UTSW 5 128754096 missense probably damaging 0.99
R4878:Piwil1 UTSW 5 128740981 missense probably damaging 0.99
R5068:Piwil1 UTSW 5 128741614 missense probably damaging 0.98
R5553:Piwil1 UTSW 5 128745501 missense probably benign 0.09
R5936:Piwil1 UTSW 5 128751078 missense probably benign 0.24
R6158:Piwil1 UTSW 5 128747876 nonsense probably null
R7663:Piwil1 UTSW 5 128747433 missense probably benign 0.00
R7772:Piwil1 UTSW 5 128739463 missense probably benign 0.06
R8133:Piwil1 UTSW 5 128749850 missense probably damaging 1.00
Z1177:Piwil1 UTSW 5 128742086 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AATCTTGTACTCGGAAGTGAGC -3'
(R):5'- TAATGCAGCTGGCTCGCTTC -3'

Sequencing Primer
(F):5'- TACTCGGAAGTGAGCTGGCTC -3'
(R):5'- AGCTGGCTCGCTTCTGCTC -3'
Posted On2016-09-01