Incidental Mutation 'R5413:Dennd2a'
ID427585
Institutional Source Beutler Lab
Gene Symbol Dennd2a
Ensembl Gene ENSMUSG00000038456
Gene NameDENN/MADD domain containing 2A
Synonyms
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location39462378-39557867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39464293 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 964 (F964I)
Ref Sequence ENSEMBL: ENSMUSP00000045367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036877]
Predicted Effect probably damaging
Transcript: ENSMUST00000036877
AA Change: F964I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045367
Gene: ENSMUSG00000038456
AA Change: F964I

DomainStartEndE-ValueType
Blast:DENN 9 430 1e-149 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 508 520 N/A INTRINSIC
uDENN 554 646 2.06e-31 SMART
DENN 653 837 7.1e-76 SMART
dDENN 888 953 1.84e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149162
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Dennd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Dennd2a APN 6 39523136 missense probably damaging 1.00
IGL01482:Dennd2a APN 6 39480309 missense probably damaging 0.98
IGL02135:Dennd2a APN 6 39480271 nonsense probably null
IGL02206:Dennd2a APN 6 39523449 missense probably damaging 1.00
IGL02649:Dennd2a APN 6 39470356 missense probably benign 0.11
IGL03057:Dennd2a APN 6 39508248 missense probably damaging 0.98
R0310:Dennd2a UTSW 6 39464201 splice site probably benign
R0326:Dennd2a UTSW 6 39497110 missense probably damaging 1.00
R0360:Dennd2a UTSW 6 39508299 missense probably benign 0.13
R0364:Dennd2a UTSW 6 39508299 missense probably benign 0.13
R0394:Dennd2a UTSW 6 39522812 missense possibly damaging 0.92
R0680:Dennd2a UTSW 6 39483062 missense probably damaging 1.00
R1741:Dennd2a UTSW 6 39493157 missense probably damaging 0.99
R1744:Dennd2a UTSW 6 39480251 missense probably benign 0.26
R2070:Dennd2a UTSW 6 39465119 missense probably damaging 1.00
R3833:Dennd2a UTSW 6 39506717 missense probably damaging 0.97
R3833:Dennd2a UTSW 6 39506723 missense probably damaging 0.98
R4120:Dennd2a UTSW 6 39465096 missense probably damaging 0.99
R4583:Dennd2a UTSW 6 39522842 missense probably damaging 1.00
R4842:Dennd2a UTSW 6 39497110 missense probably damaging 1.00
R4887:Dennd2a UTSW 6 39497159 missense probably benign 0.03
R4901:Dennd2a UTSW 6 39522687 missense probably benign 0.00
R5065:Dennd2a UTSW 6 39495176 critical splice donor site probably null
R6181:Dennd2a UTSW 6 39485620 missense probably benign 0.14
R6239:Dennd2a UTSW 6 39488816 missense probably damaging 1.00
R6360:Dennd2a UTSW 6 39493142 missense probably benign 0.01
R7115:Dennd2a UTSW 6 39506711 missense probably damaging 1.00
R7419:Dennd2a UTSW 6 39523463 missense probably damaging 1.00
R7567:Dennd2a UTSW 6 39522809 missense probably benign
R7587:Dennd2a UTSW 6 39483135 missense probably damaging 1.00
R7662:Dennd2a UTSW 6 39493103 missense probably benign 0.03
R7781:Dennd2a UTSW 6 39493066 missense probably damaging 0.99
R7962:Dennd2a UTSW 6 39480273 missense possibly damaging 0.91
X0026:Dennd2a UTSW 6 39508367 missense possibly damaging 0.61
Z1177:Dennd2a UTSW 6 39523474 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGGTAGACAGTCCACCCTGTAC -3'
(R):5'- GACTTTACGGCTTCCCACAG -3'

Sequencing Primer
(F):5'- GACAGTCCACCCTGTACCGTTC -3'
(R):5'- CCACAGACAGCTATTATACAAGGTGG -3'
Posted On2016-09-01