Incidental Mutation 'R5413:Paf1'
ID427589
Institutional Source Beutler Lab
Gene Symbol Paf1
Ensembl Gene ENSMUSG00000003437
Gene NamePaf1, RNA polymerase II complex component
Synonyms5730511K23Rik
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28392951-28399388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28396615 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 249 (M249T)
Ref Sequence ENSEMBL: ENSMUSP00000003529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003529] [ENSMUST00000003536] [ENSMUST00000040531] [ENSMUST00000207766] [ENSMUST00000208126] [ENSMUST00000208199]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003529
AA Change: M249T

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003529
Gene: ENSMUSG00000003437
AA Change: M249T

DomainStartEndE-ValueType
Pfam:Paf1 28 441 2.3e-154 PFAM
low complexity region 456 470 N/A INTRINSIC
low complexity region 476 511 N/A INTRINSIC
low complexity region 514 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000003536
SMART Domains Protein: ENSMUSP00000003536
Gene: ENSMUSG00000003444

DomainStartEndE-ValueType
Pfam:Med29 51 186 7.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208885
Predicted Effect probably benign
Transcript: ENSMUST00000207766
Predicted Effect probably benign
Transcript: ENSMUST00000208126
Predicted Effect probably benign
Transcript: ENSMUST00000208199
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the polymerase associated factor (PAF1) complex. The PAF1 complex interacts with RNA polymerase II and plays a role in transcription elongation as well as histone modifications including ubiquitylation and methylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Paf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Paf1 APN 7 28398690 unclassified probably benign
IGL02583:Paf1 APN 7 28396171 missense probably damaging 0.98
IGL02965:Paf1 APN 7 28396204 critical splice donor site probably null
IGL03117:Paf1 APN 7 28395056 missense possibly damaging 0.92
K3955:Paf1 UTSW 7 28396925 splice site probably null
P0038:Paf1 UTSW 7 28396925 splice site probably null
R0445:Paf1 UTSW 7 28395688 missense probably damaging 1.00
R1389:Paf1 UTSW 7 28398832 unclassified probably benign
R1808:Paf1 UTSW 7 28396822 missense probably damaging 1.00
R2006:Paf1 UTSW 7 28395768 splice site probably null
R5213:Paf1 UTSW 7 28395972 missense possibly damaging 0.71
R5419:Paf1 UTSW 7 28395670 missense possibly damaging 0.68
R5795:Paf1 UTSW 7 28396618 missense probably damaging 0.97
R7378:Paf1 UTSW 7 28396928 missense probably damaging 1.00
R7502:Paf1 UTSW 7 28395868 missense possibly damaging 0.91
R7629:Paf1 UTSW 7 28395068 missense probably damaging 1.00
R7896:Paf1 UTSW 7 28396647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCATGATCAGGTCTGTG -3'
(R):5'- GCCCATTGATTCATGAGGAGGAG -3'

Sequencing Primer
(F):5'- CCATGATCAGGTCTGTGGTCTTG -3'
(R):5'- TTCATGAGGAGGAGACATACTTCTG -3'
Posted On2016-09-01