Incidental Mutation 'R5413:Ldha'
ID427590
Institutional Source Beutler Lab
Gene Symbol Ldha
Ensembl Gene ENSMUSG00000063229
Gene Namelactate dehydrogenase A
Synonymsl7R2, Ldh-1, LDH-A, lactate dehydrogenase-A, Ldh1
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46841475-46855627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46850896 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 144 (T144A)
Ref Sequence ENSEMBL: ENSMUSP00000148190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005051] [ENSMUST00000048209] [ENSMUST00000092621] [ENSMUST00000125862] [ENSMUST00000132157] [ENSMUST00000133062] [ENSMUST00000147535] [ENSMUST00000209548] [ENSMUST00000209984] [ENSMUST00000210467] [ENSMUST00000210631] [ENSMUST00000210815] [ENSMUST00000210968]
Predicted Effect probably benign
Transcript: ENSMUST00000005051
AA Change: T144A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103267
Gene: ENSMUSG00000063229
AA Change: T144A

DomainStartEndE-ValueType
Pfam:Ldh_1_N 50 189 2.5e-52 PFAM
Pfam:Ldh_1_C 192 360 2.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048209
AA Change: T144A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036386
Gene: ENSMUSG00000063229
AA Change: T144A

DomainStartEndE-ValueType
Pfam:Ldh_1_N 21 160 3e-53 PFAM
Pfam:Ldh_1_C 163 331 1.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092621
AA Change: T144A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097661
Gene: ENSMUSG00000063229
AA Change: T144A

DomainStartEndE-ValueType
Pfam:Ldh_1_N 21 160 3.9e-54 PFAM
Pfam:Ldh_1_C 163 237 3.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124696
Predicted Effect probably benign
Transcript: ENSMUST00000125862
Predicted Effect possibly damaging
Transcript: ENSMUST00000132157
AA Change: T144A

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000133062
Predicted Effect probably benign
Transcript: ENSMUST00000147535
AA Change: T144A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123356
Gene: ENSMUSG00000063229
AA Change: T144A

DomainStartEndE-ValueType
Pfam:Ldh_1_N 58 197 5.7e-54 PFAM
Pfam:Ldh_1_C 200 273 5.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209548
AA Change: T144A

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209984
AA Change: T173A

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210198
Predicted Effect probably benign
Transcript: ENSMUST00000210467
Predicted Effect unknown
Transcript: ENSMUST00000210631
AA Change: D135G
Predicted Effect probably benign
Transcript: ENSMUST00000210815
AA Change: T127A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000210968
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. The protein is found predominantly in muscle tissue and belongs to the lactate dehydrogenase family. Mutations in this gene have been linked to hemolytic anemia and early postimplantation death in mice. Multiple transcript variants encoding different isoforms have been found for this gene. The mouse genome contains multiple pseudogenes of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for one chemically induced mutation exhibit severe hemolytic anemia with pronounced reticulocytosis and hyperbilirubinemia. Another mutation results in prenatal lethality in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Ldha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Ldha APN 7 46850178 missense possibly damaging 0.79
IGL01993:Ldha APN 7 46855100 missense possibly damaging 0.73
IGL02814:Ldha APN 7 46850891 nonsense probably null
R0530:Ldha UTSW 7 46853993 missense probably damaging 0.99
R1302:Ldha UTSW 7 46847639 missense probably damaging 1.00
R4948:Ldha UTSW 7 46847381 missense probably benign 0.00
R5327:Ldha UTSW 7 46854098 missense probably benign
R5543:Ldha UTSW 7 46850890 missense possibly damaging 0.94
R5763:Ldha UTSW 7 46847789 intron probably benign
R7232:Ldha UTSW 7 46850899 missense probably benign 0.31
R7660:Ldha UTSW 7 46850257 missense unknown
R8155:Ldha UTSW 7 46854084 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTGAATGTAGTTGCAAAGTTTAG -3'
(R):5'- AAGACTTACCACTGGAGTCGCC -3'

Sequencing Primer
(F):5'- TTTGATCCCAGCACTCAGGAG -3'
(R):5'- GAGTCGCCATGTTCTCCCAG -3'
Posted On2016-09-01