Incidental Mutation 'R5413:Olfr524'
ID427593
Institutional Source Beutler Lab
Gene Symbol Olfr524
Ensembl Gene ENSMUSG00000050366
Gene Nameolfactory receptor 524
SynonymsGA_x6K02T2PBJ9-42354580-42353624, MOR103-14P
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140198499-140205964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140202722 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 16 (V16E)
Ref Sequence ENSEMBL: ENSMUSP00000150970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051943] [ENSMUST00000215815]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051943
AA Change: V16E

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053565
Gene: ENSMUSG00000050366
AA Change: V16E

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 7.5e-56 PFAM
Pfam:7tm_1 42 292 6.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215815
AA Change: V16E

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Olfr524
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01991:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL01999:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL02005:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL02030:Olfr524 APN 7 140202632 missense probably damaging 0.97
IGL02474:Olfr524 APN 7 140202587 missense probably damaging 1.00
H8441:Olfr524 UTSW 7 140201958 missense possibly damaging 0.81
R0426:Olfr524 UTSW 7 140202116 missense possibly damaging 0.81
R0704:Olfr524 UTSW 7 140202635 missense probably benign 0.00
R0891:Olfr524 UTSW 7 140202459 missense probably damaging 1.00
R1624:Olfr524 UTSW 7 140201951 missense probably damaging 0.96
R1865:Olfr524 UTSW 7 140202372 missense probably damaging 1.00
R1938:Olfr524 UTSW 7 140202231 missense probably benign 0.30
R2105:Olfr524 UTSW 7 140202743 missense probably benign 0.02
R3009:Olfr524 UTSW 7 140202756 missense probably benign
R3546:Olfr524 UTSW 7 140202101 missense probably damaging 1.00
R4849:Olfr524 UTSW 7 140202427 nonsense probably null
R5009:Olfr524 UTSW 7 140201838 missense probably benign
R5105:Olfr524 UTSW 7 140202549 missense probably damaging 1.00
R5422:Olfr524 UTSW 7 140202392 missense probably damaging 1.00
R7314:Olfr524 UTSW 7 140202413 missense probably damaging 0.99
R7338:Olfr524 UTSW 7 140202533 missense probably benign 0.01
R7921:Olfr524 UTSW 7 140202299 missense probably damaging 1.00
V1662:Olfr524 UTSW 7 140201958 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCTCTAGGAAGGACAGGTTGC -3'
(R):5'- TTTAACCCCAGTGTGTACATGTTC -3'

Sequencing Primer
(F):5'- CTGAGGAAGAGGTACATAGGCTTGTG -3'
(R):5'- AGACTCATACATGCTGTGGC -3'
Posted On2016-09-01