Incidental Mutation 'R5413:Trpm5'
ID427594
Institutional Source Beutler Lab
Gene Symbol Trpm5
Ensembl Gene ENSMUSG00000009246
Gene Nametransient receptor potential cation channel, subfamily M, member 5
Synonyms9430099A16Rik, Mtr1, Ltrpc5
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location143069153-143094642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143080968 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 664 (I664N)
Ref Sequence ENSEMBL: ENSMUSP00000114302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009390] [ENSMUST00000150867]
Predicted Effect probably damaging
Transcript: ENSMUST00000009390
AA Change: I664N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009390
Gene: ENSMUSG00000009246
AA Change: I664N

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
Pfam:Ion_trans 736 989 1.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150589
Predicted Effect probably damaging
Transcript: ENSMUST00000150867
AA Change: I664N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114302
Gene: ENSMUSG00000009246
AA Change: I664N

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
transmembrane domain 731 753 N/A INTRINSIC
transmembrane domain 811 833 N/A INTRINSIC
transmembrane domain 872 894 N/A INTRINSIC
transmembrane domain 952 974 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential (TRP) protein family, which is a diverse group of proteins with structural features typical of ion channels. This protein plays an important role in taste transduction, and has characteristics of a calcium-activated, non-selective cation channel that carries Na+, K+, and Cs+ ions equally well, but not Ca(2+) ions. It is activated by lower concentrations of intracellular Ca(2+), and inhibited by higher concentrations. It is also a highly temperature-sensitive, heat activated channel showing a steep increase of inward currents at temperatures between 15 and 35 degrees Celsius. This gene is located within the Beckwith-Wiedemann syndrome critical region-1 on chromosome 11p15.5, and has been shown to be imprinted, with exclusive expression from the paternal allele. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal taste perception, responding to sour and salty stimuli but not to sweet, or bitter stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Trpm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Trpm5 APN 7 143082991 missense probably benign 0.03
IGL00717:Trpm5 APN 7 143073990 missense probably damaging 1.00
IGL01138:Trpm5 APN 7 143074569 missense probably benign
IGL01590:Trpm5 APN 7 143082734 missense probably damaging 0.99
IGL01603:Trpm5 APN 7 143075601 missense probably benign 0.04
IGL01685:Trpm5 APN 7 143082354 missense probably benign 0.05
IGL01878:Trpm5 APN 7 143074497 missense probably damaging 1.00
IGL02533:Trpm5 APN 7 143089545 missense probably benign 0.01
IGL02572:Trpm5 APN 7 143087876 splice site probably benign
IGL02750:Trpm5 APN 7 143074484 missense possibly damaging 0.89
IGL02862:Trpm5 APN 7 143082525 missense probably damaging 1.00
R0032:Trpm5 UTSW 7 143085241 missense probably damaging 1.00
R0238:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0238:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0239:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0239:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0334:Trpm5 UTSW 7 143086876 missense probably benign 0.06
R0799:Trpm5 UTSW 7 143078351 missense probably damaging 0.99
R1187:Trpm5 UTSW 7 143074469 missense probably damaging 0.96
R1373:Trpm5 UTSW 7 143086842 splice site probably benign
R1521:Trpm5 UTSW 7 143082889 missense probably benign 0.00
R1603:Trpm5 UTSW 7 143085209 missense probably benign 0.00
R1606:Trpm5 UTSW 7 143085171 nonsense probably null
R2009:Trpm5 UTSW 7 143087738 missense possibly damaging 0.58
R2437:Trpm5 UTSW 7 143082561 missense probably benign 0.03
R2508:Trpm5 UTSW 7 143088919 missense possibly damaging 0.80
R2516:Trpm5 UTSW 7 143074517 missense probably damaging 1.00
R2985:Trpm5 UTSW 7 143082938 missense probably damaging 0.99
R3036:Trpm5 UTSW 7 143085463 missense probably benign 0.00
R3037:Trpm5 UTSW 7 143085463 missense probably benign 0.00
R3688:Trpm5 UTSW 7 143078456 missense probably damaging 0.98
R4156:Trpm5 UTSW 7 143089055 missense probably benign 0.04
R4734:Trpm5 UTSW 7 143082785 missense probably benign 0.04
R4811:Trpm5 UTSW 7 143080219 missense probably damaging 1.00
R4814:Trpm5 UTSW 7 143082636 missense possibly damaging 0.50
R4847:Trpm5 UTSW 7 143087763 missense possibly damaging 0.89
R5055:Trpm5 UTSW 7 143072784 missense probably benign 0.00
R5256:Trpm5 UTSW 7 143082303 missense probably damaging 1.00
R5668:Trpm5 UTSW 7 143073229 missense probably benign 0.39
R6133:Trpm5 UTSW 7 143088951 missense probably damaging 0.98
R6242:Trpm5 UTSW 7 143073182 missense probably benign
R6564:Trpm5 UTSW 7 143072770 missense probably damaging 1.00
R6702:Trpm5 UTSW 7 143069318 unclassified probably benign
R6703:Trpm5 UTSW 7 143069318 unclassified probably benign
R6829:Trpm5 UTSW 7 143069429 unclassified probably benign
R6940:Trpm5 UTSW 7 143084810 nonsense probably null
R7337:Trpm5 UTSW 7 143089019 missense probably benign 0.01
R7513:Trpm5 UTSW 7 143081835 missense possibly damaging 0.84
R7560:Trpm5 UTSW 7 143080986 missense probably damaging 1.00
R7801:Trpm5 UTSW 7 143085241 missense probably damaging 1.00
R7961:Trpm5 UTSW 7 143080369 missense probably benign 0.00
R8009:Trpm5 UTSW 7 143080369 missense probably benign 0.00
R8189:Trpm5 UTSW 7 143081838 missense probably benign 0.32
X0022:Trpm5 UTSW 7 143083042 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCATATCCAAGCTGTCTGGC -3'
(R):5'- GGGTATCTCAGGCACACATC -3'

Sequencing Primer
(F):5'- GGCTCCTGCAGATCTTCTAGG -3'
(R):5'- TCCCTACATGAGATAAAGTGTGGTG -3'
Posted On2016-09-01