Incidental Mutation 'R5413:Wwp2'
ID427595
Institutional Source Beutler Lab
Gene Symbol Wwp2
Ensembl Gene ENSMUSG00000031930
Gene NameWW domain containing E3 ubiquitin protein ligase 2
SynonymsAIP2, 1300010O06Rik
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.641) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location107436365-107558595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107555078 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 300 (Y300N)
Ref Sequence ENSEMBL: ENSMUSP00000148813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166615] [ENSMUST00000212205] [ENSMUST00000212543]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083505
Predicted Effect probably damaging
Transcript: ENSMUST00000166615
AA Change: Y739N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132224
Gene: ENSMUSG00000031930
AA Change: Y739N

DomainStartEndE-ValueType
C2 19 115 1.52e-6 SMART
low complexity region 188 208 N/A INTRINSIC
low complexity region 237 249 N/A INTRINSIC
WW 301 330 4.61e-8 SMART
WW 331 363 4.33e-13 SMART
WW 406 437 2.86e-13 SMART
WW 445 477 3.6e-10 SMART
HECTc 534 870 3.24e-201 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212205
AA Change: Y693N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212543
AA Change: Y300N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212993
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body size, domed skull, short snout, twisted snout and overgrown mandibular incisors. Mice homozygous for a different knock-out allele exhibit increased sensitivity to pIpC-treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Wwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Wwp2 APN 8 107533291 critical splice donor site probably null
IGL01411:Wwp2 APN 8 107506345 missense probably benign 0.07
IGL01503:Wwp2 APN 8 107549781 missense probably damaging 0.97
IGL01543:Wwp2 APN 8 107483368 missense probably damaging 1.00
IGL01998:Wwp2 APN 8 107549521 missense probably damaging 1.00
IGL02020:Wwp2 APN 8 107556495 missense probably damaging 1.00
IGL02089:Wwp2 APN 8 107554057 missense probably damaging 1.00
IGL02131:Wwp2 APN 8 107552318 missense probably damaging 0.99
IGL02352:Wwp2 APN 8 107540646 nonsense probably null
IGL02359:Wwp2 APN 8 107540646 nonsense probably null
IGL02419:Wwp2 APN 8 107549815 missense probably damaging 1.00
IGL02528:Wwp2 APN 8 107554467 missense probably benign 0.06
R0639:Wwp2 UTSW 8 107517946 missense probably benign 0.01
R0834:Wwp2 UTSW 8 107556796 splice site probably benign
R1573:Wwp2 UTSW 8 107548489 missense probably damaging 1.00
R1653:Wwp2 UTSW 8 107483410 missense possibly damaging 0.49
R1782:Wwp2 UTSW 8 107506399 frame shift probably null
R1941:Wwp2 UTSW 8 107517915 missense probably benign
R2483:Wwp2 UTSW 8 107548535 missense probably damaging 1.00
R4014:Wwp2 UTSW 8 107485621 missense probably benign 0.03
R4118:Wwp2 UTSW 8 107545459 missense probably benign 0.00
R4402:Wwp2 UTSW 8 107457978 missense probably benign 0.08
R5042:Wwp2 UTSW 8 107548485 missense possibly damaging 0.95
R5117:Wwp2 UTSW 8 107554062 missense possibly damaging 0.86
R6175:Wwp2 UTSW 8 107483407 missense possibly damaging 0.95
R6232:Wwp2 UTSW 8 107506345 missense probably benign 0.03
R6323:Wwp2 UTSW 8 107540671 missense probably damaging 1.00
R6759:Wwp2 UTSW 8 107540682 missense probably damaging 1.00
R6941:Wwp2 UTSW 8 107548502 missense probably damaging 1.00
R7043:Wwp2 UTSW 8 107457900 missense probably benign 0.00
R7109:Wwp2 UTSW 8 107483356 missense probably benign 0.28
R7457:Wwp2 UTSW 8 107517960 missense probably benign 0.05
R8027:Wwp2 UTSW 8 107555477 missense probably damaging 1.00
X0066:Wwp2 UTSW 8 107518023 missense probably benign
Z1088:Wwp2 UTSW 8 107555087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCTTACCTGGGTGTCTGAG -3'
(R):5'- TCAACCTGCTATTGTGCCAGG -3'

Sequencing Primer
(F):5'- TGTCTGAGGTCCAGCAGTTAAAAG -3'
(R):5'- ATTTAAGGGCCCTGACCTCTAAG -3'
Posted On2016-09-01