Incidental Mutation 'R5413:Zwilch'
ID427596
Institutional Source Beutler Lab
Gene Symbol Zwilch
Ensembl Gene ENSMUSG00000032400
Gene Namezwilch kinetochore protein
Synonyms
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location64137144-64173104 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 64168610 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034966] [ENSMUST00000122091] [ENSMUST00000130127] [ENSMUST00000176299] [ENSMUST00000176378] [ENSMUST00000176794] [ENSMUST00000177045]
Predicted Effect probably benign
Transcript: ENSMUST00000034966
SMART Domains Protein: ENSMUSP00000034966
Gene: ENSMUSG00000032399

DomainStartEndE-ValueType
Pfam:Ribosomal_L4 22 263 9.7e-47 PFAM
Pfam:Ribos_L4_asso_C 275 349 4e-34 PFAM
low complexity region 352 367 N/A INTRINSIC
low complexity region 375 419 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122091
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124301
SMART Domains Protein: ENSMUSP00000134966
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 3e-31 PDB
Predicted Effect probably null
Transcript: ENSMUST00000130127
SMART Domains Protein: ENSMUSP00000116187
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 72 154 8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151428
Predicted Effect probably benign
Transcript: ENSMUST00000176299
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176378
SMART Domains Protein: ENSMUSP00000134782
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 1e-31 PDB
Predicted Effect probably null
Transcript: ENSMUST00000176794
SMART Domains Protein: ENSMUSP00000134850
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 257 8e-67 PFAM
Pfam:DUF2352 254 568 4.4e-131 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177045
SMART Domains Protein: ENSMUSP00000135328
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 19 303 2.2e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217055
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Other mutations in Zwilch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Zwilch APN 9 64150267 missense probably damaging 1.00
IGL02365:Zwilch APN 9 64160924 missense probably damaging 1.00
IGL02733:Zwilch APN 9 64146836 missense probably benign 0.12
IGL02818:Zwilch APN 9 64150227 missense probably damaging 0.99
R1171:Zwilch UTSW 9 64158717 missense possibly damaging 0.56
R1913:Zwilch UTSW 9 64160952 missense probably damaging 1.00
R2079:Zwilch UTSW 9 64153574 missense probably damaging 1.00
R2079:Zwilch UTSW 9 64153575 missense probably damaging 1.00
R3772:Zwilch UTSW 9 64156034 missense probably benign 0.03
R4171:Zwilch UTSW 9 64158715 nonsense probably null
R4298:Zwilch UTSW 9 64155162 critical splice donor site probably null
R4299:Zwilch UTSW 9 64155162 critical splice donor site probably null
R4901:Zwilch UTSW 9 64162746 missense probably damaging 1.00
R5106:Zwilch UTSW 9 64153584 missense probably damaging 1.00
R5208:Zwilch UTSW 9 64152923 missense probably benign 0.00
R5215:Zwilch UTSW 9 64146874 missense probably benign
R5865:Zwilch UTSW 9 64172908 start gained probably null
R6221:Zwilch UTSW 9 64161383 missense probably damaging 1.00
R6858:Zwilch UTSW 9 64153587 missense probably damaging 1.00
R6957:Zwilch UTSW 9 64162562 critical splice donor site probably null
R6995:Zwilch UTSW 9 64165449 nonsense probably null
R7104:Zwilch UTSW 9 64161376 missense probably damaging 1.00
R7595:Zwilch UTSW 9 64149264 intron probably benign
R7691:Zwilch UTSW 9 64156091 missense probably benign 0.18
R7743:Zwilch UTSW 9 64152935 missense probably damaging 1.00
R8378:Zwilch UTSW 9 64152958 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCAACAGGATGAATCTCAAATGC -3'
(R):5'- ATCCTTAGCACTGTTGTAAGCTTTC -3'

Sequencing Primer
(F):5'- ACATGGGCACACTTTTGGAC -3'
(R):5'- GTAAGCTTTCTCCACCAATGTG -3'
Posted On2016-09-01