Incidental Mutation 'R5413:Igdcc3'
ID427597
Institutional Source Beutler Lab
Gene Symbol Igdcc3
Ensembl Gene ENSMUSG00000032394
Gene Nameimmunoglobulin superfamily, DCC subclass, member 3
SynonymsPunc, WI-14920, 2810401C09Rik
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location65141189-65185872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65177515 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 189 (V189A)
Ref Sequence ENSEMBL: ENSMUSP00000149084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034961] [ENSMUST00000217371]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034961
AA Change: V189A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034961
Gene: ENSMUSG00000032394
AA Change: V189A

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
IGc2 66 136 1.28e-10 SMART
IGc2 163 228 4.77e-10 SMART
IGc2 262 326 8.06e-8 SMART
IGc2 354 419 3.17e-15 SMART
FN3 436 519 1.2e-13 SMART
FN3 534 615 2.66e-6 SMART
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217135
Predicted Effect possibly damaging
Transcript: ENSMUST00000217371
AA Change: V189A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a gene trap mutation exhibit reduced performance on the rotarod, suggesting impaired cerebellar function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Igdcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Igdcc3 APN 9 65182019 missense probably damaging 1.00
IGL01310:Igdcc3 APN 9 65178442 missense probably damaging 0.98
IGL01545:Igdcc3 APN 9 65180073 missense probably damaging 1.00
IGL01576:Igdcc3 APN 9 65177870 missense probably damaging 1.00
IGL01909:Igdcc3 APN 9 65144537 missense probably damaging 1.00
IGL02039:Igdcc3 APN 9 65183880 missense probably benign 0.18
IGL02055:Igdcc3 APN 9 65181280 missense possibly damaging 0.92
IGL02565:Igdcc3 APN 9 65180188 missense probably damaging 1.00
R1776:Igdcc3 UTSW 9 65182752 nonsense probably null
R4731:Igdcc3 UTSW 9 65181997 missense probably damaging 1.00
R5487:Igdcc3 UTSW 9 65181584 missense probably damaging 1.00
R5744:Igdcc3 UTSW 9 65141488 small deletion probably benign
R6578:Igdcc3 UTSW 9 65182019 missense probably damaging 1.00
R6867:Igdcc3 UTSW 9 65183038 missense probably damaging 1.00
R6992:Igdcc3 UTSW 9 65181571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCCTGCCTCAAGAAGAC -3'
(R):5'- ACTCTTACACAATCTCATGAGCCTAG -3'

Sequencing Primer
(F):5'- GAAGACACTGCTCCTCAGAGG -3'
(R):5'- CAATCTCATGAGCCTAGAATCTGGG -3'
Posted On2016-09-01