Incidental Mutation 'R5413:Clint1'
ID427600
Institutional Source Beutler Lab
Gene Symbol Clint1
Ensembl Gene ENSMUSG00000006169
Gene Nameclathrin interactor 1
SynonymsC530049I24Rik, Epn4
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location45852051-45910625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45886480 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 98 (V98A)
Ref Sequence ENSEMBL: ENSMUSP00000104884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109260] [ENSMUST00000109261]
Predicted Effect probably damaging
Transcript: ENSMUST00000109260
AA Change: V98A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104883
Gene: ENSMUSG00000006169
AA Change: V98A

DomainStartEndE-ValueType
ENTH 22 149 2.56e-61 SMART
low complexity region 262 279 N/A INTRINSIC
low complexity region 311 323 N/A INTRINSIC
low complexity region 332 357 N/A INTRINSIC
low complexity region 427 438 N/A INTRINSIC
low complexity region 540 563 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109261
AA Change: V98A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104884
Gene: ENSMUSG00000006169
AA Change: V98A

DomainStartEndE-ValueType
ENTH 22 149 2.56e-61 SMART
low complexity region 262 279 N/A INTRINSIC
low complexity region 311 323 N/A INTRINSIC
low complexity region 332 357 N/A INTRINSIC
low complexity region 427 438 N/A INTRINSIC
low complexity region 558 581 N/A INTRINSIC
low complexity region 587 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133715
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the epsin family of endocytic adapter proteins. The encoded protein interacts with clathrin, the adapter protein AP-1 and phosphoinositides. This protein may be involved in the formation of clathrin coated vesicles and trafficking between the trans-Golgi network and endosomes. Mutations in this gene are associated with a susceptibility to schizophrenia and psychotic disorders. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Clint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Clint1 APN 11 45909019 missense probably benign 0.20
IGL01974:Clint1 APN 11 45909035 missense probably benign 0.24
IGL02312:Clint1 APN 11 45894056 missense probably damaging 1.00
R1440:Clint1 UTSW 11 45890783 missense probably damaging 1.00
R1720:Clint1 UTSW 11 45887410 missense probably damaging 0.99
R1722:Clint1 UTSW 11 45906406 missense possibly damaging 0.68
R1736:Clint1 UTSW 11 45906177 splice site probably null
R2012:Clint1 UTSW 11 45894092 missense possibly damaging 0.77
R2334:Clint1 UTSW 11 45909028 missense probably damaging 0.97
R5260:Clint1 UTSW 11 45907942 missense probably damaging 1.00
R6331:Clint1 UTSW 11 45895081 missense probably benign 0.14
R7343:Clint1 UTSW 11 45883763 missense probably damaging 1.00
R7507:Clint1 UTSW 11 45908949 missense possibly damaging 0.94
R8045:Clint1 UTSW 11 45890739 missense possibly damaging 0.91
R8090:Clint1 UTSW 11 45887440 missense probably damaging 1.00
X0005:Clint1 UTSW 11 45906430 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGGATGAAGTTCGGACTGTC -3'
(R):5'- TTCTGCACTCGTCACACAAC -3'

Sequencing Primer
(F):5'- ATGAAGTTCGGACTGTCTTTCG -3'
(R):5'- ACCAGCAAGAGTCACATGC -3'
Posted On2016-09-01