Incidental Mutation 'R5413:Olfr10'
ID427602
Institutional Source Beutler Lab
Gene Symbol Olfr10
Ensembl Gene ENSMUSG00000100923
Gene Nameolfactory receptor 10
SynonymsMOR256-55, L45, GA_x6K02T2QP88-6117098-6116163
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49304741-49320021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49318413 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 289 (Y289F)
Ref Sequence ENSEMBL: ENSMUSP00000149724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187570] [ENSMUST00000215671] [ENSMUST00000217290]
Predicted Effect probably damaging
Transcript: ENSMUST00000187570
AA Change: Y289F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139744
Gene: ENSMUSG00000100923
AA Change: Y289F

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 35 222 4.7e-7 PFAM
Pfam:7tm_1 41 289 1.3e-33 PFAM
Pfam:7tm_4 139 282 4.6e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215671
Predicted Effect probably damaging
Transcript: ENSMUST00000217290
AA Change: Y289F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Olfr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Olfr10 APN 11 49318300 nonsense probably null 0.00
IGL02283:Olfr10 APN 11 49318335 missense probably benign
IGL03010:Olfr10 APN 11 49318146 missense probably damaging 0.99
R0575:Olfr10 UTSW 11 49318053 missense probably damaging 1.00
R1430:Olfr10 UTSW 11 49318101 unclassified probably null
R1891:Olfr10 UTSW 11 49317857 missense probably benign 0.00
R2509:Olfr10 UTSW 11 49318221 missense probably damaging 0.97
R2511:Olfr10 UTSW 11 49318221 missense probably damaging 0.97
R4942:Olfr10 UTSW 11 49317548 start codon destroyed probably null 0.99
R5080:Olfr10 UTSW 11 49318087 missense probably benign 0.03
R5843:Olfr10 UTSW 11 49318249 missense probably benign 0.34
R6354:Olfr10 UTSW 11 49317638 missense probably damaging 0.98
R6605:Olfr10 UTSW 11 49317714 missense probably damaging 0.97
R8005:Olfr10 UTSW 11 49318141 missense probably benign 0.12
R8284:Olfr10 UTSW 11 49318175 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCAGTGCCTACCATGCTC -3'
(R):5'- GTGGACAGATTCATGCATGTAC -3'

Sequencing Primer
(F):5'- AGGCTCCTATGCACAGATTG -3'
(R):5'- GGACAGATTCATGCATGTACATAAC -3'
Posted On2016-09-01