Incidental Mutation 'R5413:Vdac1'
ID427603
Institutional Source Beutler Lab
Gene Symbol Vdac1
Ensembl Gene ENSMUSG00000020402
Gene Namevoltage-dependent anion channel 1
SynonymsVdac5
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location52360860-52389397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 52374967 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 52 (L52F)
Ref Sequence ENSEMBL: ENSMUSP00000020673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020673] [ENSMUST00000102758] [ENSMUST00000125694]
Predicted Effect probably null
Transcript: ENSMUST00000020673
AA Change: L52F

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020673
Gene: ENSMUSG00000020402
AA Change: L52F

DomainStartEndE-ValueType
Pfam:Porin_3 16 289 1.7e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102758
AA Change: L39F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099819
Gene: ENSMUSG00000020402
AA Change: L39F

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 7.6e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125694
AA Change: L39F

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116919
Gene: ENSMUSG00000020402
AA Change: L39F

DomainStartEndE-ValueType
Pfam:Porin_3 3 235 1.7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157052
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a voltage-dependent anion channel protein that is a major component of the outer mitochondrial membrane. The encoded protein facilitates the exchange of metabolites and ions across the outer mitochondrial membrane and may regulate mitochondrial functions. This protein also forms channels in the plasma membrane and may be involved in transmembrane electron transport. Multiple pseudogenes of this gene are found on chromosomes 1, 2, 3, 6, 8, 9, and X. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants exhibit approximately 60% embryonic mortality, with loss occurring at embryonic day 10.5-11.5. Survivors exhibit defective cued fear conditioning and spatial learning. Heterozygotes also exhibit about 12% prenatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Vdac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Vdac1 APN 11 52385662 missense probably benign 0.02
IGL02057:Vdac1 APN 11 52376544 critical splice donor site probably null
IGL03223:Vdac1 APN 11 52376655 missense probably benign
IGL03225:Vdac1 APN 11 52376655 missense probably benign
R0362:Vdac1 UTSW 11 52374973 splice site probably benign
R1612:Vdac1 UTSW 11 52384070 missense probably benign 0.03
R1694:Vdac1 UTSW 11 52374363 missense probably damaging 0.96
R2512:Vdac1 UTSW 11 52384077 missense probably damaging 1.00
R3717:Vdac1 UTSW 11 52376646 critical splice acceptor site probably null
R4592:Vdac1 UTSW 11 52374972 splice site probably null
R5027:Vdac1 UTSW 11 52388478 missense possibly damaging 0.75
R5209:Vdac1 UTSW 11 52376452 missense probably damaging 0.99
R5256:Vdac1 UTSW 11 52384078 critical splice donor site probably null
R5762:Vdac1 UTSW 11 52387453 missense possibly damaging 0.77
R6276:Vdac1 UTSW 11 52376482 missense possibly damaging 0.84
R6954:Vdac1 UTSW 11 52386373 missense probably damaging 1.00
R7023:Vdac1 UTSW 11 52374366 missense probably damaging 0.99
R7261:Vdac1 UTSW 11 52374934 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGGTGTCCTAGCTTCAAGC -3'
(R):5'- CACCTACAGTACATTAGGCCAGAAG -3'

Sequencing Primer
(F):5'- ctccaactccTGGCTTAA -3'
(R):5'- CAGTACATTAGGCCAGAAGTTTTG -3'
Posted On2016-09-01