Incidental Mutation 'R5413:Fars2'
ID427606
Institutional Source Beutler Lab
Gene Symbol Fars2
Ensembl Gene ENSMUSG00000021420
Gene Namephenylalanine-tRNA synthetase 2 (mitochondrial)
Synonyms2810431B21Rik, Fars1, 6720478K01Rik
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location36117412-36726280 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 36204562 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 11 (Y11*)
Ref Sequence ENSEMBL: ENSMUSP00000153019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021857] [ENSMUST00000099582] [ENSMUST00000223796] [ENSMUST00000224241] [ENSMUST00000224611] [ENSMUST00000224916]
Predicted Effect probably null
Transcript: ENSMUST00000021857
AA Change: Y11*
SMART Domains Protein: ENSMUSP00000021857
Gene: ENSMUSG00000021420
AA Change: Y11*

DomainStartEndE-ValueType
Pfam:tRNA-synt_2d 69 208 3.3e-18 PFAM
Pfam:tRNA-synt_2d 223 343 9.5e-31 PFAM
FDX-ACB 358 450 1.5e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099582
SMART Domains Protein: ENSMUSP00000097177
Gene: ENSMUSG00000021420

DomainStartEndE-ValueType
Pfam:tRNA-synt_2d 4 111 2.6e-33 PFAM
FDX-ACB 126 218 1.5e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223796
AA Change: Y11*
Predicted Effect probably null
Transcript: ENSMUST00000224241
AA Change: Y11*
Predicted Effect probably null
Transcript: ENSMUST00000224611
AA Change: Y11*
Predicted Effect probably null
Transcript: ENSMUST00000224916
AA Change: Y11*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225525
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that transfers phenylalanine to its cognate tRNA. This protein localizes to the mitochondrion and plays a role in mitochondrial protein translation. Mutations in this gene can cause combined oxidative phosphorylation deficiency 14 (Alpers encephalopathy). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Fars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Fars2 APN 13 36537311 missense probably benign 0.07
IGL02348:Fars2 APN 13 36537380 missense probably benign 0.00
IGL02406:Fars2 APN 13 36410162 missense probably benign 0.39
IGL02523:Fars2 APN 13 36204693 missense probably damaging 1.00
IGL02896:Fars2 APN 13 36204842 missense probably benign 0.02
IGL03299:Fars2 APN 13 36537410 nonsense probably null
IGL03308:Fars2 APN 13 36204687 missense possibly damaging 0.95
R0419:Fars2 UTSW 13 36537311 missense probably benign 0.07
R0546:Fars2 UTSW 13 36204586 missense probably benign 0.01
R1918:Fars2 UTSW 13 36204546 missense probably damaging 1.00
R3120:Fars2 UTSW 13 36246417 missense probably damaging 1.00
R3844:Fars2 UTSW 13 36205101 missense probably damaging 1.00
R4716:Fars2 UTSW 13 36205068 missense probably damaging 1.00
R4795:Fars2 UTSW 13 36537426 missense probably damaging 0.97
R4796:Fars2 UTSW 13 36537426 missense probably damaging 0.97
R4979:Fars2 UTSW 13 36204581 missense possibly damaging 0.54
R5262:Fars2 UTSW 13 36342018 missense probably damaging 1.00
R5475:Fars2 UTSW 13 36204570 missense probably benign
R5635:Fars2 UTSW 13 36410146 missense probably damaging 0.99
R6437:Fars2 UTSW 13 36204863 missense possibly damaging 0.80
R7637:Fars2 UTSW 13 36204775 missense probably benign 0.40
R7676:Fars2 UTSW 13 36205043 missense probably benign 0.07
R8013:Fars2 UTSW 13 36205085 nonsense probably null
R8014:Fars2 UTSW 13 36205085 nonsense probably null
R8063:Fars2 UTSW 13 36204897 nonsense probably null
R8273:Fars2 UTSW 13 36410110 missense probably damaging 1.00
X0020:Fars2 UTSW 13 36204795 missense probably damaging 1.00
Z1177:Fars2 UTSW 13 36204731 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGAGCCCTGTTGCTTTG -3'
(R):5'- TTCCTGCCCACCTTGGAAAG -3'

Sequencing Primer
(F):5'- CACCTTTAGTACCATACATGACAGTG -3'
(R):5'- CTTGGAAAGGACCTTCTGGG -3'
Posted On2016-09-01