Incidental Mutation 'R5413:Homer1'
ID427607
Institutional Source Beutler Lab
Gene Symbol Homer1
Ensembl Gene ENSMUSG00000007617
Gene Namehomer scaffolding protein 1
SynonymsPSD-Zip45, Ves-1
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location93299635-93405129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93391779 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 274 (E274G)
Ref Sequence ENSEMBL: ENSMUSP00000078093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060490] [ENSMUST00000079086] [ENSMUST00000080127] [ENSMUST00000109495] [ENSMUST00000109496] [ENSMUST00000109497] [ENSMUST00000109498]
Predicted Effect probably benign
Transcript: ENSMUST00000060490
AA Change: E258G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000050471
Gene: ENSMUSG00000007617
AA Change: E258G

DomainStartEndE-ValueType
WH1 1 107 4.27e-46 SMART
low complexity region 255 268 N/A INTRINSIC
PDB:3CVE|D 290 354 2e-34 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000079086
AA Change: E274G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078093
Gene: ENSMUSG00000007617
AA Change: E274G

DomainStartEndE-ValueType
WH1 17 123 2.73e-44 SMART
low complexity region 271 284 N/A INTRINSIC
PDB:3CVE|D 306 370 3e-34 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000080127
AA Change: E270G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000079026
Gene: ENSMUSG00000007617
AA Change: E270G

DomainStartEndE-ValueType
WH1 1 107 4.27e-46 SMART
low complexity region 267 280 N/A INTRINSIC
PDB:3CVE|D 302 366 2e-34 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109495
SMART Domains Protein: ENSMUSP00000105121
Gene: ENSMUSG00000007617

DomainStartEndE-ValueType
WH1 1 107 4.27e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109496
AA Change: E128G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105122
Gene: ENSMUSG00000007617
AA Change: E128G

DomainStartEndE-ValueType
WH1 1 107 1.01e-38 SMART
low complexity region 125 138 N/A INTRINSIC
PDB:3CVE|D 160 224 2e-35 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109497
AA Change: E84G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105123
Gene: ENSMUSG00000007617
AA Change: E84G

DomainStartEndE-ValueType
low complexity region 81 94 N/A INTRINSIC
PDB:3CVE|D 116 180 9e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109498
AA Change: E96G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105124
Gene: ENSMUSG00000007617
AA Change: E96G

DomainStartEndE-ValueType
low complexity region 93 106 N/A INTRINSIC
PDB:3CVE|D 128 192 9e-36 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homer family of dendritic proteins. Members of this family regulate group 1 metabotrophic glutamate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit an increase in spontaneous calcium influx in pancreatic acinar cells. Mice homozygous for a knock-out allele exhibit decreased response to formalin-induced pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Fbxl16 C A 17: 25,816,843 T138K possibly damaging Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Homer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Homer1 APN 13 93387688 splice site probably benign
IGL00427:Homer1 APN 13 93402114 missense probably benign 0.05
IGL00479:Homer1 APN 13 93346648 missense probably damaging 1.00
PIT4151001:Homer1 UTSW 13 93349216 missense probably damaging 1.00
R0153:Homer1 UTSW 13 93391746 missense possibly damaging 0.92
R3025:Homer1 UTSW 13 93402074 nonsense probably null
R3437:Homer1 UTSW 13 93366421 intron probably benign
R4418:Homer1 UTSW 13 93402069 missense probably damaging 1.00
R4666:Homer1 UTSW 13 93402159 missense probably damaging 0.99
R4718:Homer1 UTSW 13 93391764 missense probably damaging 1.00
R5665:Homer1 UTSW 13 93356102 missense probably benign 0.03
R5798:Homer1 UTSW 13 93402095 missense probably damaging 1.00
R6092:Homer1 UTSW 13 93366437 intron probably benign
R6486:Homer1 UTSW 13 93391725 missense possibly damaging 0.73
R6617:Homer1 UTSW 13 93341862 missense probably damaging 1.00
R7101:Homer1 UTSW 13 93356054 missense probably benign 0.00
R7384:Homer1 UTSW 13 93393039 missense possibly damaging 0.90
R8362:Homer1 UTSW 13 93366289 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCTCAGGTGCTGTGACCT -3'
(R):5'- CAGGAAAACCAGGAACAAGCTTTAT -3'

Sequencing Primer
(F):5'- TGACCTAAGCAGGAAGCCTCTG -3'
(R):5'- AGGTCCTGAGTTCAAATCCG -3'
Posted On2016-09-01