Incidental Mutation 'R5413:Fbxl16'
ID427611
Institutional Source Beutler Lab
Gene Symbol Fbxl16
Ensembl Gene ENSMUSG00000025738
Gene NameF-box and leucine-rich repeat protein 16
Synonyms
MMRRC Submission 042982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R5413 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25809085-25821244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25816843 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 138 (T138K)
Ref Sequence ENSEMBL: ENSMUSP00000048562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045692]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045692
AA Change: T138K

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048562
Gene: ENSMUSG00000025738
AA Change: T138K

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
Blast:FBOX 98 137 2e-14 BLAST
LRR 241 266 1.32e1 SMART
LRR 267 291 1.61e2 SMART
LRR 293 318 1.76e2 SMART
LRR 319 344 3.21e-4 SMART
LRR 345 370 7.67e-2 SMART
LRR 371 396 6.13e-1 SMART
LRR 421 446 3.52e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL16, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,020,377 T410S possibly damaging Het
Adamts3 A G 5: 89,708,767 S316P probably damaging Het
Angptl3 A T 4: 99,031,022 L6F probably benign Het
Clint1 T C 11: 45,886,480 V98A probably damaging Het
Clk2 A G 3: 89,173,478 N258S probably benign Het
Col18a1 T C 10: 77,069,476 D723G probably damaging Het
Csmd3 A T 15: 47,838,435 W1751R probably damaging Het
Daam1 C A 12: 71,946,292 L352M unknown Het
Dennd2a A T 6: 39,464,293 F964I probably damaging Het
Dock5 A G 14: 67,764,655 L1622P probably damaging Het
Dpy19l4 A G 4: 11,289,700 L195P probably damaging Het
Esp24 A C 17: 39,040,002 E31A possibly damaging Het
Fars2 T A 13: 36,204,562 Y11* probably null Het
Frmpd1 A G 4: 45,249,196 I129V probably benign Het
Gria1 A G 11: 57,217,794 N241S probably benign Het
Homer1 A G 13: 93,391,779 E274G probably benign Het
Igdcc3 T C 9: 65,177,515 V189A possibly damaging Het
Igkv12-98 A G 6: 68,571,094 Y68C possibly damaging Het
Igkv3-3 G C 6: 70,687,430 R85S probably damaging Het
Ldha A G 7: 46,850,896 T144A possibly damaging Het
Lrp1 A G 10: 127,588,067 probably null Het
Myh9 A T 15: 77,807,986 Y124* probably null Het
Olfr10 A T 11: 49,318,413 Y289F probably damaging Het
Olfr136 G T 17: 38,335,624 A156S probably benign Het
Olfr301 A G 7: 86,412,467 Y35C probably benign Het
Olfr524 A T 7: 140,202,722 V16E possibly damaging Het
Osbp T C 19: 11,984,491 Y551H probably damaging Het
Paf1 T C 7: 28,396,615 M249T possibly damaging Het
Pcsk2 T C 2: 143,696,700 probably null Het
Piwil1 G A 5: 128,743,880 V290I possibly damaging Het
Prmt9 A T 8: 77,572,009 D444V possibly damaging Het
Rapgef2 T C 3: 79,087,866 D677G probably damaging Het
Tmem59 A G 4: 107,200,462 E237G probably benign Het
Trpm5 A T 7: 143,080,968 I664N probably damaging Het
Unc13b G A 4: 43,257,936 probably null Het
Usp17lc C A 7: 103,418,556 Q353K probably benign Het
Uvssa G A 5: 33,410,908 V547M probably damaging Het
Vdac1 G T 11: 52,374,967 L52F probably null Het
Vmn2r14 T A 5: 109,221,288 I140L probably benign Het
Wnt3a A G 11: 59,275,356 S33P probably benign Het
Wwp2 T A 8: 107,555,078 Y300N probably damaging Het
Zwilch T A 9: 64,168,610 probably null Het
Other mutations in Fbxl16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Fbxl16 APN 17 25819364 splice site probably benign
BB002:Fbxl16 UTSW 17 25816906 missense probably benign 0.00
BB012:Fbxl16 UTSW 17 25816906 missense probably benign 0.00
R1848:Fbxl16 UTSW 17 25816446 missense probably benign
R6018:Fbxl16 UTSW 17 25817735 missense probably damaging 1.00
R6048:Fbxl16 UTSW 17 25816993 missense probably benign 0.44
R6352:Fbxl16 UTSW 17 25818945 missense probably damaging 0.99
R7068:Fbxl16 UTSW 17 25819511 missense possibly damaging 0.86
R7089:Fbxl16 UTSW 17 25816729 missense probably benign 0.00
R7925:Fbxl16 UTSW 17 25816906 missense probably benign 0.00
R8065:Fbxl16 UTSW 17 25817983 missense probably damaging 0.99
R8067:Fbxl16 UTSW 17 25817983 missense probably damaging 0.99
X0025:Fbxl16 UTSW 17 25818515 missense probably damaging 1.00
Z1176:Fbxl16 UTSW 17 25817011 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TACACCACTATCCCGGGTTG -3'
(R):5'- GGCCTTGACTCCCTTCTTAGAG -3'

Sequencing Primer
(F):5'- ACTATCCCGGGTTGCTCTGG -3'
(R):5'- GACTCCCTTCTTAGAGAGAGAATAG -3'
Posted On2016-09-01