Incidental Mutation 'R5414:Acan'
ID427634
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
MMRRC Submission 042983-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5414 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79100988 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1836 (T1836A)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect probably benign
Transcript: ENSMUST00000032835
AA Change: T1836A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: T1836A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206779
AA Change: T413A
Meta Mutation Damage Score 0.0662 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,314,622 S278P probably damaging Het
Akr1c18 T A 13: 4,136,735 D238V probably damaging Het
Akt3 A G 1: 177,050,251 V317A probably damaging Het
Atp2b2 G A 6: 113,842,141 P64S probably damaging Het
Atr A G 9: 95,870,704 N609S probably benign Het
Bcat1 A G 6: 145,015,447 probably null Het
C1rl C T 6: 124,508,468 A266V probably damaging Het
Cd34 A G 1: 194,947,911 E51G probably benign Het
Celsr3 A G 9: 108,840,042 E2161G possibly damaging Het
Clec2h G T 6: 128,674,786 A153S probably benign Het
Cnih1 T C 14: 46,778,983 T105A probably benign Het
Coro1c A G 5: 113,848,546 I279T possibly damaging Het
Ddx11 A G 17: 66,148,768 T721A probably benign Het
Fbn2 C A 18: 58,093,405 A766S probably damaging Het
Focad C T 4: 88,410,702 probably benign Het
Galnt16 A T 12: 80,584,048 D300V probably damaging Het
Gbp2b T C 3: 142,599,091 L96P probably damaging Het
Gm10192 T C 4: 97,183,109 S20G probably null Het
Gm10288 T C 3: 146,838,962 noncoding transcript Het
Gm21761 A C 13: 119,912,336 D139E probably damaging Het
Gm4181 C T 14: 51,635,590 probably null Het
Gm6327 T A 16: 12,760,358 noncoding transcript Het
Hfm1 A G 5: 106,902,076 I409T probably damaging Het
Ibtk T C 9: 85,726,689 E390G possibly damaging Het
Ifit1bl1 T A 19: 34,593,924 I378F probably damaging Het
Kcnh4 T C 11: 100,746,896 D645G probably damaging Het
Krt33b T C 11: 100,029,786 T14A probably benign Het
Lrch3 T A 16: 32,985,965 probably null Het
Mycbp2 A T 14: 103,306,261 L226H probably damaging Het
Myo1e C A 9: 70,322,358 probably null Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nploc4 A T 11: 120,413,643 Y251N probably damaging Het
Olfr1271 T C 2: 90,265,702 T243A probably benign Het
Pdk4 T C 6: 5,485,499 I397V probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pgm5 A G 19: 24,709,325 I506T probably damaging Het
Pgs1 T G 11: 118,014,676 I499S probably damaging Het
Ppp6r3 A G 19: 3,507,330 S253P probably damaging Het
Prag1 C G 8: 36,139,622 P839R probably benign Het
Rin3 C T 12: 102,389,857 Q806* probably null Het
Ros1 T C 10: 52,155,093 D484G probably damaging Het
Scamp5 A G 9: 57,447,224 V49A probably benign Het
Sis C A 3: 72,952,493 V310L probably benign Het
Svep1 T C 4: 58,206,322 T19A possibly damaging Het
Tenm3 A C 8: 48,236,355 S2066A probably damaging Het
Thra A G 11: 98,760,957 I102V probably benign Het
Trim30a A C 7: 104,411,141 V476G probably damaging Het
Vmn2r3 T A 3: 64,259,557 R718* probably null Het
Washc4 A G 10: 83,556,103 T218A possibly damaging Het
Xrcc1 A G 7: 24,570,218 Y401C probably damaging Het
Zfp629 T C 7: 127,611,282 T452A probably damaging Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
R8482:Acan UTSW 7 79096744 missense probably benign 0.02
R8511:Acan UTSW 7 79097935 missense possibly damaging 0.94
R8716:Acan UTSW 7 79112690 missense probably damaging 1.00
R8753:Acan UTSW 7 79098768 missense possibly damaging 0.83
R8810:Acan UTSW 7 79099704 missense probably damaging 1.00
R8898:Acan UTSW 7 79100353 missense possibly damaging 0.59
R8956:Acan UTSW 7 79100965 missense probably benign 0.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCATGGAATCACTTCTGCC -3'
(R):5'- ATCTGTCAGGGACATGGTTG -3'

Sequencing Primer
(F):5'- TGCCTTCCATGAAACAGATCTGG -3'
(R):5'- CAGGGACATGGTTGTTTCTGC -3'
Posted On2016-09-01