Incidental Mutation 'R5414:Washc4'
ID427645
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
MMRRC Submission 042983-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5414 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83556103 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 218 (T218A)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038388
AA Change: T218A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: T218A

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Meta Mutation Damage Score 0.0623 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,314,622 S278P probably damaging Het
Acan A G 7: 79,100,988 T1836A probably benign Het
Akr1c18 T A 13: 4,136,735 D238V probably damaging Het
Akt3 A G 1: 177,050,251 V317A probably damaging Het
Atp2b2 G A 6: 113,842,141 P64S probably damaging Het
Atr A G 9: 95,870,704 N609S probably benign Het
Bcat1 A G 6: 145,015,447 probably null Het
C1rl C T 6: 124,508,468 A266V probably damaging Het
Cd34 A G 1: 194,947,911 E51G probably benign Het
Celsr3 A G 9: 108,840,042 E2161G possibly damaging Het
Clec2h G T 6: 128,674,786 A153S probably benign Het
Cnih1 T C 14: 46,778,983 T105A probably benign Het
Coro1c A G 5: 113,848,546 I279T possibly damaging Het
Ddx11 A G 17: 66,148,768 T721A probably benign Het
Fbn2 C A 18: 58,093,405 A766S probably damaging Het
Focad C T 4: 88,410,702 probably benign Het
Galnt16 A T 12: 80,584,048 D300V probably damaging Het
Gbp2b T C 3: 142,599,091 L96P probably damaging Het
Gm10192 T C 4: 97,183,109 S20G probably null Het
Gm10288 T C 3: 146,838,962 noncoding transcript Het
Gm21761 A C 13: 119,912,336 D139E probably damaging Het
Gm4181 C T 14: 51,635,590 probably null Het
Gm6327 T A 16: 12,760,358 noncoding transcript Het
Hfm1 A G 5: 106,902,076 I409T probably damaging Het
Ibtk T C 9: 85,726,689 E390G possibly damaging Het
Ifit1bl1 T A 19: 34,593,924 I378F probably damaging Het
Kcnh4 T C 11: 100,746,896 D645G probably damaging Het
Krt33b T C 11: 100,029,786 T14A probably benign Het
Lrch3 T A 16: 32,985,965 probably null Het
Mycbp2 A T 14: 103,306,261 L226H probably damaging Het
Myo1e C A 9: 70,322,358 probably null Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nploc4 A T 11: 120,413,643 Y251N probably damaging Het
Olfr1271 T C 2: 90,265,702 T243A probably benign Het
Pdk4 T C 6: 5,485,499 I397V probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pgm5 A G 19: 24,709,325 I506T probably damaging Het
Pgs1 T G 11: 118,014,676 I499S probably damaging Het
Ppp6r3 A G 19: 3,507,330 S253P probably damaging Het
Prag1 C G 8: 36,139,622 P839R probably benign Het
Rin3 C T 12: 102,389,857 Q806* probably null Het
Ros1 T C 10: 52,155,093 D484G probably damaging Het
Scamp5 A G 9: 57,447,224 V49A probably benign Het
Sis C A 3: 72,952,493 V310L probably benign Het
Svep1 T C 4: 58,206,322 T19A possibly damaging Het
Tenm3 A C 8: 48,236,355 S2066A probably damaging Het
Thra A G 11: 98,760,957 I102V probably benign Het
Trim30a A C 7: 104,411,141 V476G probably damaging Het
Vmn2r3 T A 3: 64,259,557 R718* probably null Het
Xrcc1 A G 7: 24,570,218 Y401C probably damaging Het
Zfp629 T C 7: 127,611,282 T452A probably damaging Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
R7144:Washc4 UTSW 10 83573774 critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83591033 missense probably damaging 0.99
R7477:Washc4 UTSW 10 83574443 missense probably damaging 0.99
R7983:Washc4 UTSW 10 83573773 splice site probably null
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGTACATTTGAGGGTAAGACCTG -3'
(R):5'- TGCTTACAGAGGAAACCTGAGTC -3'

Sequencing Primer
(F):5'- GGGTAAGACCTGAATCTTAATAAACC -3'
(R):5'- GTGACTTACAACAGCCTATGACTCTG -3'
Posted On2016-09-01