Incidental Mutation 'R5415:Ect2'
ID427672
Institutional Source Beutler Lab
Gene Symbol Ect2
Ensembl Gene ENSMUSG00000027699
Gene Nameect2 oncogene
Synonyms
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5415 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location27097222-27153878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27146853 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 126 (C126Y)
Ref Sequence ENSEMBL: ENSMUSP00000135740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108298] [ENSMUST00000108300] [ENSMUST00000175857] [ENSMUST00000176242] [ENSMUST00000176535] [ENSMUST00000176780] [ENSMUST00000177055] [ENSMUST00000184113]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108296
Predicted Effect probably damaging
Transcript: ENSMUST00000108298
AA Change: C126Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103933
Gene: ENSMUSG00000027699
AA Change: C126Y

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108300
AA Change: C157Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103935
Gene: ENSMUSG00000027699
AA Change: C157Y

DomainStartEndE-ValueType
BRCT 174 250 1.45e-10 SMART
BRCT 268 344 2.52e-10 SMART
low complexity region 362 372 N/A INTRINSIC
RhoGEF 456 640 3.22e-67 SMART
Blast:PH 667 794 1e-80 BLAST
low complexity region 856 870 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175857
AA Change: C156Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135208
Gene: ENSMUSG00000027699
AA Change: C156Y

DomainStartEndE-ValueType
Blast:BRCT 139 161 2e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176242
AA Change: C126Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135740
Gene: ENSMUSG00000027699
AA Change: C126Y

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176535
AA Change: C157Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135630
Gene: ENSMUSG00000027699
AA Change: C157Y

DomainStartEndE-ValueType
Blast:BRCT 140 162 4e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176780
AA Change: C126Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134786
Gene: ENSMUSG00000027699
AA Change: C126Y

DomainStartEndE-ValueType
SCOP:d1gzhb1 117 174 5e-5 SMART
Blast:BRCT 143 174 4e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177055
AA Change: C156Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134744
Gene: ENSMUSG00000027699
AA Change: C156Y

DomainStartEndE-ValueType
Blast:BRCT 139 161 3e-6 BLAST
Predicted Effect silent
Transcript: ENSMUST00000184113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196926
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor and transforming protein that is related to Rho-specific exchange factors and yeast cell cycle regulators. The expression of this gene is elevated with the onset of DNA synthesis and remains elevated during G2 and M phases. In situ hybridization analysis showed that expression is at a high level in cells undergoing mitosis in regenerating liver. Thus, this protein is expressed in a cell cycle-dependent manner during liver regeneration, and is thought to have an important role in the regulation of cytokinesis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Homozygous disruption of this locus is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Ect2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ect2 APN 3 27138669 missense probably benign 0.04
IGL00770:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL00774:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL01414:Ect2 APN 3 27127729 splice site probably benign
IGL02017:Ect2 APN 3 27122044 nonsense probably null
IGL02318:Ect2 APN 3 27138719 missense probably benign 0.16
IGL02395:Ect2 APN 3 27150106 missense probably damaging 1.00
IGL03109:Ect2 APN 3 27144972 missense possibly damaging 0.88
IGL03178:Ect2 APN 3 27148860 missense probably benign 0.03
IGL03055:Ect2 UTSW 3 27137062 missense probably damaging 1.00
PIT4504001:Ect2 UTSW 3 27126948 nonsense probably null
R0090:Ect2 UTSW 3 27115476 missense probably benign 0.00
R0090:Ect2 UTSW 3 27138502 missense probably null 0.08
R0436:Ect2 UTSW 3 27150095 missense probably benign 0.11
R0620:Ect2 UTSW 3 27139652 missense probably damaging 0.99
R1847:Ect2 UTSW 3 27150072 missense probably benign 0.01
R2404:Ect2 UTSW 3 27131850 missense probably benign 0.00
R3890:Ect2 UTSW 3 27138540 missense probably damaging 1.00
R3951:Ect2 UTSW 3 27130120 missense probably benign 0.00
R4588:Ect2 UTSW 3 27147000 missense probably damaging 1.00
R4754:Ect2 UTSW 3 27126963 missense probably damaging 1.00
R5051:Ect2 UTSW 3 27102486 missense probably benign
R5254:Ect2 UTSW 3 27130070 missense probably damaging 1.00
R5786:Ect2 UTSW 3 27146953 missense probably damaging 1.00
R5940:Ect2 UTSW 3 27115465 missense probably benign 0.01
R5974:Ect2 UTSW 3 27144963 nonsense probably null
R6012:Ect2 UTSW 3 27098325 utr 3 prime probably benign
R6434:Ect2 UTSW 3 27139119 nonsense probably null
R6447:Ect2 UTSW 3 27115484 missense probably damaging 1.00
R6850:Ect2 UTSW 3 27138885 missense probably damaging 1.00
R6989:Ect2 UTSW 3 27102488 nonsense probably null
R7147:Ect2 UTSW 3 27150090 missense probably benign 0.12
R7257:Ect2 UTSW 3 27138535 missense probably damaging 1.00
R7417:Ect2 UTSW 3 27098419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAAGCCAGGACTCATGG -3'
(R):5'- CAGGAGTCAATTTTAGGGAGTCG -3'

Sequencing Primer
(F):5'- GCATGAGCCACCATACCCAG -3'
(R):5'- CAGGAAATGAAAGTGCCC -3'
Posted On2016-09-01