Incidental Mutation 'R5415:Vmn1r60'
ID427682
Institutional Source Beutler Lab
Gene Symbol Vmn1r60
Ensembl Gene ENSMUSG00000090794
Gene Namevomeronasal 1 receptor 60
SynonymsGm7184
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5415 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5544172-5545178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5544417 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 228 (H228R)
Ref Sequence ENSEMBL: ENSMUSP00000133943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173782]
Predicted Effect probably benign
Transcript: ENSMUST00000172111
AA Change: H228R

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133113
Gene: ENSMUSG00000090794
AA Change: H228R

DomainStartEndE-ValueType
Pfam:TAS2R 1 294 1.1e-10 PFAM
Pfam:7tm_1 20 280 7.3e-12 PFAM
Pfam:V1R 31 299 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173782
AA Change: H228R

PolyPhen 2 Score 0.384 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133943
Gene: ENSMUSG00000090794
AA Change: H228R

DomainStartEndE-ValueType
Pfam:TAS2R 8 304 4.7e-10 PFAM
Pfam:7tm_1 30 289 7.2e-6 PFAM
Pfam:V1R 41 309 1.8e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Vmn1r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Vmn1r60 APN 7 5544229 missense probably benign 0.05
IGL01892:Vmn1r60 APN 7 5544310 missense probably benign 0.02
IGL02427:Vmn1r60 APN 7 5544781 missense probably damaging 1.00
IGL03071:Vmn1r60 APN 7 5544369 missense probably damaging 0.97
R0200:Vmn1r60 UTSW 7 5544380 missense probably benign
R0457:Vmn1r60 UTSW 7 5545119 start gained probably benign
R1175:Vmn1r60 UTSW 7 5544622 missense probably benign 0.01
R1199:Vmn1r60 UTSW 7 5544972 missense probably damaging 0.99
R1529:Vmn1r60 UTSW 7 5544903 missense probably benign 0.00
R1859:Vmn1r60 UTSW 7 5544550 missense possibly damaging 0.64
R2033:Vmn1r60 UTSW 7 5544820 missense probably benign
R2405:Vmn1r60 UTSW 7 5544913 missense probably benign
R3408:Vmn1r60 UTSW 7 5545149 utr 5 prime probably null
R3771:Vmn1r60 UTSW 7 5544711 missense possibly damaging 0.76
R3773:Vmn1r60 UTSW 7 5544711 missense possibly damaging 0.76
R3852:Vmn1r60 UTSW 7 5545027 missense possibly damaging 0.79
R4236:Vmn1r60 UTSW 7 5544804 missense probably benign 0.06
R4331:Vmn1r60 UTSW 7 5544365 nonsense probably null
R4439:Vmn1r60 UTSW 7 5544489 missense probably damaging 1.00
R5099:Vmn1r60 UTSW 7 5544817 missense probably damaging 0.98
R5325:Vmn1r60 UTSW 7 5544202 missense probably benign
R5818:Vmn1r60 UTSW 7 5545099 start codon destroyed probably benign 0.04
R6375:Vmn1r60 UTSW 7 5545018 missense probably damaging 0.96
R6378:Vmn1r60 UTSW 7 5544783 missense probably damaging 0.99
R6478:Vmn1r60 UTSW 7 5544865 missense probably damaging 1.00
R6572:Vmn1r60 UTSW 7 5544600 missense probably benign 0.40
R6586:Vmn1r60 UTSW 7 5544447 missense probably benign 0.00
R7061:Vmn1r60 UTSW 7 5544311 nonsense probably null
R7506:Vmn1r60 UTSW 7 5544862 missense
Predicted Primers PCR Primer
(F):5'- TGATGTGCACAGAACAATGAC -3'
(R):5'- AAAGGCAATTCGATATGCTCCATC -3'

Sequencing Primer
(F):5'- GATGTGCACAGAACAATGACCCTTAC -3'
(R):5'- AATTCGATATGCTCCATCTCTGGG -3'
Posted On2016-09-01