Incidental Mutation 'R5415:Cd177'
ID427685
Institutional Source Beutler Lab
Gene Symbol Cd177
Ensembl Gene ENSMUSG00000052212
Gene NameCD177 antigen
SynonymsPdp3, 1190003K14Rik
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.574) question?
Stock #R5415 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24743983-24760311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24752391 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 400 (L400Q)
Ref Sequence ENSEMBL: ENSMUSP00000064934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063956]
Predicted Effect probably damaging
Transcript: ENSMUST00000063956
AA Change: L400Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064934
Gene: ENSMUSG00000052212
AA Change: L400Q

DomainStartEndE-ValueType
Pfam:UPAR_LY6 134 214 3.7e-11 PFAM
Pfam:UPAR_LY6 226 300 1.2e-4 PFAM
low complexity region 301 317 N/A INTRINSIC
Pfam:UPAR_LY6 322 400 1.5e-9 PFAM
Pfam:UPAR_LY6 511 586 9.1e-12 PFAM
Pfam:UPAR_LY6 705 782 1.4e-11 PFAM
low complexity region 795 811 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206160
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating neutrophils, increased neutrophil cell death and decreased neutrophils and monocytes early after S. aureus infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Cd177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cd177 APN 7 24759751 missense possibly damaging 0.59
IGL00479:Cd177 APN 7 24758015 missense probably benign 0.05
IGL00673:Cd177 APN 7 24752017 missense possibly damaging 0.78
IGL00913:Cd177 APN 7 24756195 missense probably damaging 1.00
IGL01445:Cd177 APN 7 24752071 missense possibly damaging 0.95
IGL02021:Cd177 APN 7 24745206 missense probably benign 0.16
IGL02134:Cd177 APN 7 24752352 missense probably benign 0.01
IGL02532:Cd177 APN 7 24745249 missense probably benign 0.30
IGL02821:Cd177 APN 7 24744393 missense probably damaging 1.00
IGL02821:Cd177 APN 7 24744394 missense probably damaging 1.00
IGL02888:Cd177 APN 7 24758437 missense probably damaging 0.99
R0506:Cd177 UTSW 7 24758356 missense probably damaging 1.00
R0601:Cd177 UTSW 7 24752313 missense probably benign 0.00
R0631:Cd177 UTSW 7 24756686 missense probably benign 0.03
R0713:Cd177 UTSW 7 24744430 missense probably benign 0.25
R1595:Cd177 UTSW 7 24744964 missense probably benign
R1659:Cd177 UTSW 7 24746137 missense probably damaging 1.00
R2258:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2260:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2379:Cd177 UTSW 7 24758043 missense possibly damaging 0.80
R2763:Cd177 UTSW 7 24758037 missense probably benign 0.05
R2929:Cd177 UTSW 7 24754279 nonsense probably null
R3815:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3818:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3919:Cd177 UTSW 7 24744433 missense probably benign 0.15
R4300:Cd177 UTSW 7 24750420 missense possibly damaging 0.48
R4494:Cd177 UTSW 7 24752003 missense probably benign 0.06
R4781:Cd177 UTSW 7 24750626 missense probably damaging 1.00
R4819:Cd177 UTSW 7 24752271 missense probably damaging 1.00
R5062:Cd177 UTSW 7 24744316 missense probably benign 0.03
R5186:Cd177 UTSW 7 24744923 missense probably benign 0.31
R5285:Cd177 UTSW 7 24746249 missense probably benign 0.00
R5577:Cd177 UTSW 7 24745137 missense probably damaging 1.00
R5637:Cd177 UTSW 7 24756323 missense probably benign 0.01
R5673:Cd177 UTSW 7 24750362 missense probably damaging 1.00
R5731:Cd177 UTSW 7 24744421 missense probably damaging 1.00
R5775:Cd177 UTSW 7 24752268 missense probably damaging 1.00
R5840:Cd177 UTSW 7 24758070 missense probably damaging 0.99
R5870:Cd177 UTSW 7 24756332 missense probably benign 0.00
R5872:Cd177 UTSW 7 24752263 missense probably null 1.00
R6148:Cd177 UTSW 7 24744273 nonsense probably null
R6505:Cd177 UTSW 7 24744246 missense probably benign 0.00
R6897:Cd177 UTSW 7 24745074 missense probably benign 0.31
R7023:Cd177 UTSW 7 24759762 missense probably benign 0.44
R7088:Cd177 UTSW 7 24745133 nonsense probably null
R7188:Cd177 UTSW 7 24756647 missense probably damaging 1.00
R7366:Cd177 UTSW 7 24756722 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAAGTTCACCTGCTCTC -3'
(R):5'- ACAGCTAGACCCTGAGACTC -3'

Sequencing Primer
(F):5'- TGCTCTCCTGGGCAGATAGAAG -3'
(R):5'- TAGACCCTGAGACTCATGGG -3'
Posted On2016-09-01