Incidental Mutation 'R5415:A430078G23Rik'
ID427686
Institutional Source Beutler Lab
Gene Symbol A430078G23Rik
Ensembl Gene ENSMUSG00000074497
Gene NameRIKEN cDNA A430078G23 gene
Synonyms
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5415 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3353415-3390299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3388075 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 303 (R303H)
Ref Sequence ENSEMBL: ENSMUSP00000096566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004684] [ENSMUST00000098966] [ENSMUST00000145394] [ENSMUST00000208363]
Predicted Effect probably benign
Transcript: ENSMUST00000004684
SMART Domains Protein: ENSMUSP00000004684
Gene: ENSMUSG00000004568

DomainStartEndE-ValueType
RhoGEF 105 297 2.62e-58 SMART
PH 340 443 5.57e-12 SMART
low complexity region 446 456 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
coiled coil region 697 800 N/A INTRINSIC
low complexity region 887 897 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 963 985 N/A INTRINSIC
low complexity region 991 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098966
AA Change: R303H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096566
Gene: ENSMUSG00000074497
AA Change: R303H

DomainStartEndE-ValueType
low complexity region 116 134 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131773
Predicted Effect probably benign
Transcript: ENSMUST00000145394
Predicted Effect probably benign
Transcript: ENSMUST00000208363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208845
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in A430078G23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:A430078G23Rik APN 8 3381942 missense possibly damaging 0.62
IGL01743:A430078G23Rik APN 8 3364697 missense probably benign 0.01
IGL03334:A430078G23Rik APN 8 3388023 missense probably benign 0.04
R0417:A430078G23Rik UTSW 8 3388957 utr 3 prime probably benign
R0646:A430078G23Rik UTSW 8 3386959 missense probably damaging 0.99
R0759:A430078G23Rik UTSW 8 3388822 utr 3 prime probably benign
R0880:A430078G23Rik UTSW 8 3389032 utr 3 prime probably benign
R0980:A430078G23Rik UTSW 8 3389095 utr 3 prime probably benign
R1175:A430078G23Rik UTSW 8 3389023 utr 3 prime probably benign
R1649:A430078G23Rik UTSW 8 3389094 utr 3 prime probably benign
R1781:A430078G23Rik UTSW 8 3380495 missense probably damaging 0.98
R2211:A430078G23Rik UTSW 8 3387680 missense possibly damaging 0.95
R2843:A430078G23Rik UTSW 8 3364634 missense possibly damaging 0.82
R5319:A430078G23Rik UTSW 8 3385010 critical splice donor site probably null
R5588:A430078G23Rik UTSW 8 3388878 utr 3 prime probably benign
R6455:A430078G23Rik UTSW 8 3388753 missense probably benign 0.16
R7573:A430078G23Rik UTSW 8 3384918 missense probably damaging 0.96
R7664:A430078G23Rik UTSW 8 3386390 missense probably damaging 0.98
R7731:A430078G23Rik UTSW 8 3384936 missense probably damaging 0.99
R7845:A430078G23Rik UTSW 8 3386959 missense probably damaging 0.99
R8167:A430078G23Rik UTSW 8 3353636 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGACTTCACCTAGAGAGC -3'
(R):5'- ATCTCCTGCAGAGGCTAGTC -3'

Sequencing Primer
(F):5'- TAATCACAGGTTCAAGGGCTGC -3'
(R):5'- GCAGAGGCTAGTCTTTTTACGCC -3'
Posted On2016-09-01