Incidental Mutation 'R5415:Cideb'
ID427694
Institutional Source Beutler Lab
Gene Symbol Cideb
Ensembl Gene ENSMUSG00000022219
Gene Namecell death-inducing DNA fragmentation factor, alpha subunit-like effector B
Synonyms1110030C18Rik, CIDE-B, DFFA-like B
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5415 (G1)
Quality Score200
Status Not validated
Chromosome14
Chromosomal Location55754050-55758458 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55757855 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 58 (E58G)
Ref Sequence ENSEMBL: ENSMUSP00000001497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001497] [ENSMUST00000019441] [ENSMUST00000044554]
Predicted Effect probably damaging
Transcript: ENSMUST00000001497
AA Change: E58G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001497
Gene: ENSMUSG00000022219
AA Change: E58G

DomainStartEndE-ValueType
CAD 36 108 2.16e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019441
SMART Domains Protein: ENSMUSP00000019441
Gene: ENSMUSG00000019297

DomainStartEndE-ValueType
low complexity region 11 55 N/A INTRINSIC
Blast:Pumilio 92 127 3e-15 BLAST
Pumilio 189 220 2.74e2 SMART
Blast:Pumilio 263 298 3e-14 BLAST
Pumilio 314 349 4.38e1 SMART
Pumilio 351 387 1.03e1 SMART
Pumilio 509 546 1.72e1 SMART
Pumilio 547 582 9.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044554
SMART Domains Protein: ENSMUSP00000048358
Gene: ENSMUSG00000040432

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
Pfam:7tm_1 37 288 5.7e-31 PFAM
low complexity region 309 323 N/A INTRINSIC
low complexity region 337 351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228302
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a lean phenotype, increased energy expenditure and improved insulin sensitivity and are resistant to high-fat diet-induced obesity, hyperlipidemia, or liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Cideb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Cideb APN 14 55754560 missense possibly damaging 0.78
Oxymoron UTSW 14 55757952 missense probably benign 0.43
R1526:Cideb UTSW 14 55755162 nonsense probably null
R1920:Cideb UTSW 14 55755243 missense probably benign
R2073:Cideb UTSW 14 55755160 missense possibly damaging 0.88
R4584:Cideb UTSW 14 55758270 missense probably benign
R4650:Cideb UTSW 14 55755231 missense possibly damaging 0.92
R5106:Cideb UTSW 14 55754525 missense probably benign
R5420:Cideb UTSW 14 55758291 start codon destroyed probably null 1.00
R6471:Cideb UTSW 14 55757952 missense probably benign 0.43
R7234:Cideb UTSW 14 55754560 missense probably benign 0.03
R7455:Cideb UTSW 14 55754835 missense probably damaging 1.00
X0064:Cideb UTSW 14 55757976 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCTACTGTTCCTCTGCCAAAG -3'
(R):5'- TTATCAACAAGTTTGCCAACCC -3'

Sequencing Primer
(F):5'- TGTTCCTCTGCCAAAGAAAGC -3'
(R):5'- TGTGAGCTCGGAGTTAAG -3'
Posted On2016-09-01