Incidental Mutation 'R5416:Gm13941'
ID427711
Institutional Source Beutler Lab
Gene Symbol Gm13941
Ensembl Gene ENSMUSG00000079170
Gene Namepredicted gene 13941
Synonyms
MMRRC Submission 042985-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5416 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111088372-111105982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111094734 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 175 (S175T)
Ref Sequence ENSEMBL: ENSMUSP00000115383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127918]
Predicted Effect unknown
Transcript: ENSMUST00000127918
AA Change: S175T
SMART Domains Protein: ENSMUSP00000115383
Gene: ENSMUSG00000079170
AA Change: S175T

DomainStartEndE-ValueType
low complexity region 225 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,907,596 E689D probably damaging Het
Acsl6 A G 11: 54,337,171 E339G probably benign Het
Adcy3 G A 12: 4,209,308 E861K probably damaging Het
Adrm1 C T 2: 180,176,137 T394I probably benign Het
Adsl T A 15: 80,952,183 probably null Het
Asxl3 T A 18: 22,524,494 C1854S probably damaging Het
C87436 A G 6: 86,465,850 Y458C probably damaging Het
Cacna1e T C 1: 154,465,779 D1161G probably damaging Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cdh18 A G 15: 23,226,723 Y90C probably damaging Het
Chadl T C 15: 81,693,899 R510G probably benign Het
Clcnkb T C 4: 141,413,900 T115A probably benign Het
Clptm1 C A 7: 19,633,816 probably benign Het
Col24a1 A T 3: 145,315,025 R386* probably null Het
Ctsj G T 13: 61,004,523 L10M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx40 T C 11: 86,797,691 D302G probably benign Het
Edrf1 T C 7: 133,641,402 F166L possibly damaging Het
Epha1 A T 6: 42,365,871 M248K probably damaging Het
Evpl C A 11: 116,234,259 V126L probably benign Het
Fam83d T C 2: 158,785,632 C414R possibly damaging Het
Fat2 T C 11: 55,303,688 N1175S possibly damaging Het
Fhad1 G A 4: 141,918,802 T283I probably benign Het
Fuca1 A G 4: 135,922,980 T121A probably damaging Het
Gpr107 T A 2: 31,185,548 I357N probably damaging Het
Gpr161 T A 1: 165,321,461 H466Q probably benign Het
Hsd3b5 A G 3: 98,619,150 F327L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Itgb7 A T 15: 102,217,309 D628E probably benign Het
Nwd1 A G 8: 72,666,694 D236G possibly damaging Het
Olfr214 A T 6: 116,557,205 Y260F probably damaging Het
Olfr663 C T 7: 104,703,716 L50F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 A G 18: 37,356,955 Y562C probably damaging Het
Phkg2 A G 7: 127,582,935 H376R possibly damaging Het
Plxnc1 G A 10: 94,837,554 T1018I probably damaging Het
Ppp6r1 A T 7: 4,639,748 D532E possibly damaging Het
Prkdc T C 16: 15,805,950 L3259P probably damaging Het
Prkg2 A T 5: 98,943,467 D641E probably benign Het
Psg26 T C 7: 18,482,600 T105A probably benign Het
Ptprs T C 17: 56,435,724 T473A probably damaging Het
Pwp2 G T 10: 78,183,001 N57K probably damaging Het
Rnf216 G T 5: 143,015,771 C733* probably null Het
Serpina1f T A 12: 103,693,944 K26N possibly damaging Het
Sez6l2 T A 7: 126,961,886 C448S probably damaging Het
Slc28a3 A T 13: 58,576,793 L216M probably damaging Het
Sorbs1 A G 19: 40,376,989 S117P probably benign Het
Sorl1 A T 9: 42,002,636 C1332* probably null Het
Specc1 T C 11: 62,118,909 V497A probably benign Het
Tmem204 T C 17: 25,058,326 E195G probably damaging Het
Tnfrsf13b T C 11: 61,147,023 probably null Het
Ttll5 G A 12: 86,012,828 V1250M possibly damaging Het
Ube4a G A 9: 44,941,178 T681I probably damaging Het
Ubqln3 C T 7: 104,141,672 V404I probably benign Het
Yeats2 T C 16: 20,211,569 S919P probably benign Het
Zfp575 C T 7: 24,586,722 G3D probably benign Het
Zfp644 C T 5: 106,618,428 silent Het
Other mutations in Gm13941
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Gm13941 APN 2 111104853 missense unknown
IGL00420:Gm13941 APN 2 111091848 splice site probably benign
IGL01149:Gm13941 APN 2 111101137 missense unknown
IGL01319:Gm13941 APN 2 111094805 critical splice acceptor site probably null
IGL02557:Gm13941 APN 2 111101156 missense unknown
IGL03163:Gm13941 APN 2 111098416 missense unknown
R0067:Gm13941 UTSW 2 111059416 unclassified noncoding transcript
R0918:Gm13941 UTSW 2 111100600 missense unknown
R2315:Gm13941 UTSW 2 111104817 missense unknown
R3847:Gm13941 UTSW 2 111104853 missense unknown
R3848:Gm13941 UTSW 2 111104853 missense unknown
R5574:Gm13941 UTSW 2 111100606 missense unknown
R6389:Gm13941 UTSW 2 111098389 missense unknown
R6616:Gm13941 UTSW 2 111101175 missense unknown
R7056:Gm13941 UTSW 2 111096802 missense unknown
R7455:Gm13941 UTSW 2 111094740 missense unknown
Z1177:Gm13941 UTSW 2 111094778 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTTCCTTAGACATCACTCAAACTGAC -3'
(R):5'- CAAGAAATGTGCTCCATGTGAG -3'

Sequencing Primer
(F):5'- GACATCACTCAAACTGACATCTTTG -3'
(R):5'- CCGAATTTGTTGCTTCGA -3'
Posted On2016-09-01