Incidental Mutation 'R5416:Col24a1'
ID 427715
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 042985-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5416 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 145020786 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 386 (R386*)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]
AlphaFold Q30D77
Predicted Effect probably null
Transcript: ENSMUST00000029848
AA Change: R386*
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: R386*

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139001
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,871,331 (GRCm39) E689D probably damaging Het
Acsl6 A G 11: 54,227,997 (GRCm39) E339G probably benign Het
Adcy3 G A 12: 4,259,308 (GRCm39) E861K probably damaging Het
Adrm1 C T 2: 179,817,930 (GRCm39) T394I probably benign Het
Adsl T A 15: 80,836,384 (GRCm39) probably null Het
Asxl3 T A 18: 22,657,551 (GRCm39) C1854S probably damaging Het
C87436 A G 6: 86,442,832 (GRCm39) Y458C probably damaging Het
Cacna1e T C 1: 154,341,525 (GRCm39) D1161G probably damaging Het
Ccdc187 G A 2: 26,166,104 (GRCm39) P775L possibly damaging Het
Ccr1 G T 9: 123,764,413 (GRCm39) P39H probably damaging Het
Cdh18 A G 15: 23,226,809 (GRCm39) Y90C probably damaging Het
Chadl T C 15: 81,578,100 (GRCm39) R510G probably benign Het
Clcnkb T C 4: 141,141,211 (GRCm39) T115A probably benign Het
Clptm1 C A 7: 19,367,741 (GRCm39) probably benign Het
Ctsj G T 13: 61,152,337 (GRCm39) L10M probably damaging Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dhx40 T C 11: 86,688,517 (GRCm39) D302G probably benign Het
Edrf1 T C 7: 133,243,131 (GRCm39) F166L possibly damaging Het
Epha1 A T 6: 42,342,805 (GRCm39) M248K probably damaging Het
Evpl C A 11: 116,125,085 (GRCm39) V126L probably benign Het
Fam83d T C 2: 158,627,552 (GRCm39) C414R possibly damaging Het
Fat2 T C 11: 55,194,514 (GRCm39) N1175S possibly damaging Het
Fhad1 G A 4: 141,646,113 (GRCm39) T283I probably benign Het
Fuca1 A G 4: 135,650,291 (GRCm39) T121A probably damaging Het
Gm13941 A T 2: 110,925,079 (GRCm39) S175T unknown Het
Gpr107 T A 2: 31,075,560 (GRCm39) I357N probably damaging Het
Gpr161 T A 1: 165,149,030 (GRCm39) H466Q probably benign Het
Hsd3b5 A G 3: 98,526,466 (GRCm39) F327L probably damaging Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Itgb7 A T 15: 102,125,744 (GRCm39) D628E probably benign Het
Nwd1 A G 8: 73,393,322 (GRCm39) D236G possibly damaging Het
Or56b2j C T 7: 104,352,923 (GRCm39) L50F probably benign Het
Or6d14 A T 6: 116,534,166 (GRCm39) Y260F probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pcdhb8 A G 18: 37,490,008 (GRCm39) Y562C probably damaging Het
Phkg2 A G 7: 127,182,107 (GRCm39) H376R possibly damaging Het
Plxnc1 G A 10: 94,673,416 (GRCm39) T1018I probably damaging Het
Ppp6r1 A T 7: 4,642,747 (GRCm39) D532E possibly damaging Het
Prkdc T C 16: 15,623,814 (GRCm39) L3259P probably damaging Het
Prkg2 A T 5: 99,091,326 (GRCm39) D641E probably benign Het
Psg26 T C 7: 18,216,525 (GRCm39) T105A probably benign Het
Ptprs T C 17: 56,742,724 (GRCm39) T473A probably damaging Het
Pwp2 G T 10: 78,018,835 (GRCm39) N57K probably damaging Het
Rnf216 G T 5: 143,001,526 (GRCm39) C733* probably null Het
Serpina1f T A 12: 103,660,203 (GRCm39) K26N possibly damaging Het
Sez6l2 T A 7: 126,561,058 (GRCm39) C448S probably damaging Het
Slc28a3 A T 13: 58,724,607 (GRCm39) L216M probably damaging Het
Sorbs1 A G 19: 40,365,433 (GRCm39) S117P probably benign Het
Sorl1 A T 9: 41,913,932 (GRCm39) C1332* probably null Het
Specc1 T C 11: 62,009,735 (GRCm39) V497A probably benign Het
Tmem204 T C 17: 25,277,300 (GRCm39) E195G probably damaging Het
Tnfrsf13b T C 11: 61,037,849 (GRCm39) probably null Het
Ttll5 G A 12: 86,059,602 (GRCm39) V1250M possibly damaging Het
Ube4a G A 9: 44,852,476 (GRCm39) T681I probably damaging Het
Ubqln3 C T 7: 103,790,879 (GRCm39) V404I probably benign Het
Yeats2 T C 16: 20,030,319 (GRCm39) S919P probably benign Het
Zfp575 C T 7: 24,286,147 (GRCm39) G3D probably benign Het
Zfp644 C T 5: 106,766,294 (GRCm39) silent Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTGCCACGGTACATGAAAG -3'
(R):5'- TACAAGGTGCTGTTTAAGATCCG -3'

Sequencing Primer
(F):5'- GCCACGGTACATGAAAGCCAAG -3'
(R):5'- AAGATCCGTTCCATTTCTATGAGC -3'
Posted On 2016-09-01