Incidental Mutation 'R5416:Col24a1'
ID 427715
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 042985-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5416 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 145292472-145552011 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 145315025 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 386 (R386*)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]
AlphaFold Q30D77
Predicted Effect probably null
Transcript: ENSMUST00000029848
AA Change: R386*
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: R386*

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139001
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,907,596 E689D probably damaging Het
Acsl6 A G 11: 54,337,171 E339G probably benign Het
Adcy3 G A 12: 4,209,308 E861K probably damaging Het
Adrm1 C T 2: 180,176,137 T394I probably benign Het
Adsl T A 15: 80,952,183 probably null Het
Asxl3 T A 18: 22,524,494 C1854S probably damaging Het
C87436 A G 6: 86,465,850 Y458C probably damaging Het
Cacna1e T C 1: 154,465,779 D1161G probably damaging Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cdh18 A G 15: 23,226,723 Y90C probably damaging Het
Chadl T C 15: 81,693,899 R510G probably benign Het
Clcnkb T C 4: 141,413,900 T115A probably benign Het
Clptm1 C A 7: 19,633,816 probably benign Het
Ctsj G T 13: 61,004,523 L10M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx40 T C 11: 86,797,691 D302G probably benign Het
Edrf1 T C 7: 133,641,402 F166L possibly damaging Het
Epha1 A T 6: 42,365,871 M248K probably damaging Het
Evpl C A 11: 116,234,259 V126L probably benign Het
Fam83d T C 2: 158,785,632 C414R possibly damaging Het
Fat2 T C 11: 55,303,688 N1175S possibly damaging Het
Fhad1 G A 4: 141,918,802 T283I probably benign Het
Fuca1 A G 4: 135,922,980 T121A probably damaging Het
Gm13941 A T 2: 111,094,734 S175T unknown Het
Gpr107 T A 2: 31,185,548 I357N probably damaging Het
Gpr161 T A 1: 165,321,461 H466Q probably benign Het
Hsd3b5 A G 3: 98,619,150 F327L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Itgb7 A T 15: 102,217,309 D628E probably benign Het
Nwd1 A G 8: 72,666,694 D236G possibly damaging Het
Olfr214 A T 6: 116,557,205 Y260F probably damaging Het
Olfr663 C T 7: 104,703,716 L50F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 A G 18: 37,356,955 Y562C probably damaging Het
Phkg2 A G 7: 127,582,935 H376R possibly damaging Het
Plxnc1 G A 10: 94,837,554 T1018I probably damaging Het
Ppp6r1 A T 7: 4,639,748 D532E possibly damaging Het
Prkdc T C 16: 15,805,950 L3259P probably damaging Het
Prkg2 A T 5: 98,943,467 D641E probably benign Het
Psg26 T C 7: 18,482,600 T105A probably benign Het
Ptprs T C 17: 56,435,724 T473A probably damaging Het
Pwp2 G T 10: 78,183,001 N57K probably damaging Het
Rnf216 G T 5: 143,015,771 C733* probably null Het
Serpina1f T A 12: 103,693,944 K26N possibly damaging Het
Sez6l2 T A 7: 126,961,886 C448S probably damaging Het
Slc28a3 A T 13: 58,576,793 L216M probably damaging Het
Sorbs1 A G 19: 40,376,989 S117P probably benign Het
Sorl1 A T 9: 42,002,636 C1332* probably null Het
Specc1 T C 11: 62,118,909 V497A probably benign Het
Tmem204 T C 17: 25,058,326 E195G probably damaging Het
Tnfrsf13b T C 11: 61,147,023 probably null Het
Ttll5 G A 12: 86,012,828 V1250M possibly damaging Het
Ube4a G A 9: 44,941,178 T681I probably damaging Het
Ubqln3 C T 7: 104,141,672 V404I probably benign Het
Yeats2 T C 16: 20,211,569 S919P probably benign Het
Zfp575 C T 7: 24,586,722 G3D probably benign Het
Zfp644 C T 5: 106,618,428 silent Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145362309 missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145461470 missense probably benign 0.00
IGL01160:Col24a1 APN 3 145507713 missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145314876 missense probably benign 0.07
IGL01409:Col24a1 APN 3 145538564 missense probably benign 0.19
IGL01587:Col24a1 APN 3 145433355 splice site probably null
IGL01666:Col24a1 APN 3 145344686 missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145524263 splice site probably benign
IGL01721:Col24a1 APN 3 145538567 missense probably benign 0.26
IGL01939:Col24a1 APN 3 145315244 missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145524167 splice site probably null
IGL02002:Col24a1 APN 3 145356944 missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145314962 missense probably benign 0.34
IGL02552:Col24a1 APN 3 145474207 missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145314173 missense probably benign
IGL02582:Col24a1 APN 3 145314486 missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145492301 nonsense probably null
IGL02942:Col24a1 APN 3 145541665 missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145538703 critical splice donor site probably null
IGL03108:Col24a1 APN 3 145323401 missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145313983 splice site probably benign
IGL03405:Col24a1 APN 3 145315157 missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145524142 missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145545316 splice site probably benign
R0556:Col24a1 UTSW 3 145314728 missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 145293145 missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145314120 missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145328759 missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145460838 missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145389600 critical splice donor site probably null
R1713:Col24a1 UTSW 3 145366869 nonsense probably null
R1854:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145537267 critical splice donor site probably null
R1969:Col24a1 UTSW 3 145314930 missense probably benign 0.03
R2216:Col24a1 UTSW 3 145314981 missense probably benign 0.34
R2290:Col24a1 UTSW 3 145513195 missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145337860 missense probably benign 0.01
R3772:Col24a1 UTSW 3 145545286 missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145461437 missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145524282 nonsense probably null
R4433:Col24a1 UTSW 3 145314383 missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145314383 missense probably benign 0.00
R4972:Col24a1 UTSW 3 145509684 missense probably benign 0.42
R5157:Col24a1 UTSW 3 145345951 nonsense probably null
R5216:Col24a1 UTSW 3 145315310 missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145484678 missense probably benign 0.03
R5334:Col24a1 UTSW 3 145461525 missense possibly damaging 0.91
R5473:Col24a1 UTSW 3 145537261 missense probably benign 0.41
R5538:Col24a1 UTSW 3 145293121 missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145298827 missense probably benign 0.26
R5648:Col24a1 UTSW 3 145358566 missense probably benign 0.00
R5920:Col24a1 UTSW 3 145428230 missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145314380 missense probably benign 0.00
R6728:Col24a1 UTSW 3 145315196 missense probably benign
R6734:Col24a1 UTSW 3 145508674 missense probably benign 0.06
R6861:Col24a1 UTSW 3 145460834 missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145315046 nonsense probably null
R7001:Col24a1 UTSW 3 145298866 missense probably benign 0.28
R7148:Col24a1 UTSW 3 145315299 missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145486304 nonsense probably null
R7315:Col24a1 UTSW 3 145431870 missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 145293165 critical splice donor site probably null
R7371:Col24a1 UTSW 3 145343698 missense probably benign 0.06
R7383:Col24a1 UTSW 3 145298838 missense probably benign
R7605:Col24a1 UTSW 3 145538687 missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145314453 missense probably benign 0.00
R7679:Col24a1 UTSW 3 145399355 missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145315011 missense probably benign
R7701:Col24a1 UTSW 3 145366901 splice site probably null
R7805:Col24a1 UTSW 3 145314140 missense probably benign 0.02
R7913:Col24a1 UTSW 3 145431866 nonsense probably null
R7921:Col24a1 UTSW 3 145474238 missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145314164 missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145507702 missense probably benign 0.31
R8294:Col24a1 UTSW 3 145481089 missense probably null 1.00
R8305:Col24a1 UTSW 3 145474182 missense probably benign 0.00
R8430:Col24a1 UTSW 3 145315299 missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145545265 missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145314037 missense probably null
R9056:Col24a1 UTSW 3 145315248 missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145481124 nonsense probably null
R9612:Col24a1 UTSW 3 145545205 missense probably benign 0.32
R9777:Col24a1 UTSW 3 145315342 nonsense probably null
Z1176:Col24a1 UTSW 3 145342498 missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145342499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTGCCACGGTACATGAAAG -3'
(R):5'- TACAAGGTGCTGTTTAAGATCCG -3'

Sequencing Primer
(F):5'- GCCACGGTACATGAAAGCCAAG -3'
(R):5'- AAGATCCGTTCCATTTCTATGAGC -3'
Posted On 2016-09-01