Mutagenetix > Incidental Mutation

Incidental Mutation 'R5416:Col24a1'

427715

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

042985-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5416 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 145315025 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 386 (R386*)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]

AlphaFold

Q30D77

Predicted Effect

probably null
Transcript: ENSMUST00000029848
AA Change: R386*

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: R386*

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139001

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,907,596	E689D	probably damaging	Het
Acsl6	A	G	11: 54,337,171	E339G	probably benign	Het
Adcy3	G	A	12: 4,209,308	E861K	probably damaging	Het
Adrm1	C	T	2: 180,176,137	T394I	probably benign	Het
Adsl	T	A	15: 80,952,183		probably null	Het
Asxl3	T	A	18: 22,524,494	C1854S	probably damaging	Het
C87436	A	G	6: 86,465,850	Y458C	probably damaging	Het
Cacna1e	T	C	1: 154,465,779	D1161G	probably damaging	Het
Ccdc187	G	A	2: 26,276,092	P775L	possibly damaging	Het
Ccr1	G	T	9: 123,964,376	P39H	probably damaging	Het
Cdh18	A	G	15: 23,226,723	Y90C	probably damaging	Het
Chadl	T	C	15: 81,693,899	R510G	probably benign	Het
Clcnkb	T	C	4: 141,413,900	T115A	probably benign	Het
Clptm1	C	A	7: 19,633,816		probably benign	Het
Ctsj	G	T	13: 61,004,523	L10M	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dhx40	T	C	11: 86,797,691	D302G	probably benign	Het
Edrf1	T	C	7: 133,641,402	F166L	possibly damaging	Het
Epha1	A	T	6: 42,365,871	M248K	probably damaging	Het
Evpl	C	A	11: 116,234,259	V126L	probably benign	Het
Fam83d	T	C	2: 158,785,632	C414R	possibly damaging	Het
Fat2	T	C	11: 55,303,688	N1175S	possibly damaging	Het
Fhad1	G	A	4: 141,918,802	T283I	probably benign	Het
Fuca1	A	G	4: 135,922,980	T121A	probably damaging	Het
Gm13941	A	T	2: 111,094,734	S175T	unknown	Het
Gpr107	T	A	2: 31,185,548	I357N	probably damaging	Het
Gpr161	T	A	1: 165,321,461	H466Q	probably benign	Het
Hsd3b5	A	G	3: 98,619,150	F327L	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Itgb7	A	T	15: 102,217,309	D628E	probably benign	Het
Nwd1	A	G	8: 72,666,694	D236G	possibly damaging	Het
Olfr214	A	T	6: 116,557,205	Y260F	probably damaging	Het
Olfr663	C	T	7: 104,703,716	L50F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdhb8	A	G	18: 37,356,955	Y562C	probably damaging	Het
Phkg2	A	G	7: 127,582,935	H376R	possibly damaging	Het
Plxnc1	G	A	10: 94,837,554	T1018I	probably damaging	Het
Ppp6r1	A	T	7: 4,639,748	D532E	possibly damaging	Het
Prkdc	T	C	16: 15,805,950	L3259P	probably damaging	Het
Prkg2	A	T	5: 98,943,467	D641E	probably benign	Het
Psg26	T	C	7: 18,482,600	T105A	probably benign	Het
Ptprs	T	C	17: 56,435,724	T473A	probably damaging	Het
Pwp2	G	T	10: 78,183,001	N57K	probably damaging	Het
Rnf216	G	T	5: 143,015,771	C733*	probably null	Het
Serpina1f	T	A	12: 103,693,944	K26N	possibly damaging	Het
Sez6l2	T	A	7: 126,961,886	C448S	probably damaging	Het
Slc28a3	A	T	13: 58,576,793	L216M	probably damaging	Het
Sorbs1	A	G	19: 40,376,989	S117P	probably benign	Het
Sorl1	A	T	9: 42,002,636	C1332*	probably null	Het
Specc1	T	C	11: 62,118,909	V497A	probably benign	Het
Tmem204	T	C	17: 25,058,326	E195G	probably damaging	Het
Tnfrsf13b	T	C	11: 61,147,023		probably null	Het
Ttll5	G	A	12: 86,012,828	V1250M	possibly damaging	Het
Ube4a	G	A	9: 44,941,178	T681I	probably damaging	Het
Ubqln3	C	T	7: 104,141,672	V404I	probably benign	Het
Yeats2	T	C	16: 20,211,569	S919P	probably benign	Het
Zfp575	C	T	7: 24,586,722	G3D	probably benign	Het
Zfp644	C	T	5: 106,618,428		silent	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTCTGCCACGGTACATGAAAG -3'
(R):5'- TACAAGGTGCTGTTTAAGATCCG -3'

Sequencing Primer
(F):5'- GCCACGGTACATGAAAGCCAAG -3'
(R):5'- AAGATCCGTTCCATTTCTATGAGC -3'

Posted On

2016-09-01