Incidental Mutation 'R5416:C87436'
ID427725
Institutional Source Beutler Lab
Gene Symbol C87436
Ensembl Gene ENSMUSG00000046679
Gene Nameexpressed sequence C87436
Synonyms
MMRRC Submission 042985-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R5416 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86438374-86473500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86465850 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 458 (Y458C)
Ref Sequence ENSEMBL: ENSMUSP00000109328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050497] [ENSMUST00000113698] [ENSMUST00000113700] [ENSMUST00000133753] [ENSMUST00000141972]
Predicted Effect probably damaging
Transcript: ENSMUST00000050497
AA Change: Y468C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057461
Gene: ENSMUSG00000046679
AA Change: Y468C

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 1.1e-22 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113698
AA Change: Y458C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109328
Gene: ENSMUSG00000046679
AA Change: Y458C

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 1e-22 PFAM
low complexity region 278 290 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113700
AA Change: Y468C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109330
Gene: ENSMUSG00000046679
AA Change: Y468C

DomainStartEndE-ValueType
Pfam:zf-tcix 16 57 1.3e-22 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129343
Predicted Effect probably benign
Transcript: ENSMUST00000133753
SMART Domains Protein: ENSMUSP00000121520
Gene: ENSMUSG00000046679

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 6.2e-23 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141972
SMART Domains Protein: ENSMUSP00000115916
Gene: ENSMUSG00000046679

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 6.2e-23 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154066
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,907,596 E689D probably damaging Het
Acsl6 A G 11: 54,337,171 E339G probably benign Het
Adcy3 G A 12: 4,209,308 E861K probably damaging Het
Adrm1 C T 2: 180,176,137 T394I probably benign Het
Adsl T A 15: 80,952,183 probably null Het
Asxl3 T A 18: 22,524,494 C1854S probably damaging Het
Cacna1e T C 1: 154,465,779 D1161G probably damaging Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cdh18 A G 15: 23,226,723 Y90C probably damaging Het
Chadl T C 15: 81,693,899 R510G probably benign Het
Clcnkb T C 4: 141,413,900 T115A probably benign Het
Clptm1 C A 7: 19,633,816 probably benign Het
Col24a1 A T 3: 145,315,025 R386* probably null Het
Ctsj G T 13: 61,004,523 L10M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx40 T C 11: 86,797,691 D302G probably benign Het
Edrf1 T C 7: 133,641,402 F166L possibly damaging Het
Epha1 A T 6: 42,365,871 M248K probably damaging Het
Evpl C A 11: 116,234,259 V126L probably benign Het
Fam83d T C 2: 158,785,632 C414R possibly damaging Het
Fat2 T C 11: 55,303,688 N1175S possibly damaging Het
Fhad1 G A 4: 141,918,802 T283I probably benign Het
Fuca1 A G 4: 135,922,980 T121A probably damaging Het
Gm13941 A T 2: 111,094,734 S175T unknown Het
Gpr107 T A 2: 31,185,548 I357N probably damaging Het
Gpr161 T A 1: 165,321,461 H466Q probably benign Het
Hsd3b5 A G 3: 98,619,150 F327L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Itgb7 A T 15: 102,217,309 D628E probably benign Het
Nwd1 A G 8: 72,666,694 D236G possibly damaging Het
Olfr214 A T 6: 116,557,205 Y260F probably damaging Het
Olfr663 C T 7: 104,703,716 L50F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 A G 18: 37,356,955 Y562C probably damaging Het
Phkg2 A G 7: 127,582,935 H376R possibly damaging Het
Plxnc1 G A 10: 94,837,554 T1018I probably damaging Het
Ppp6r1 A T 7: 4,639,748 D532E possibly damaging Het
Prkdc T C 16: 15,805,950 L3259P probably damaging Het
Prkg2 A T 5: 98,943,467 D641E probably benign Het
Psg26 T C 7: 18,482,600 T105A probably benign Het
Ptprs T C 17: 56,435,724 T473A probably damaging Het
Pwp2 G T 10: 78,183,001 N57K probably damaging Het
Rnf216 G T 5: 143,015,771 C733* probably null Het
Serpina1f T A 12: 103,693,944 K26N possibly damaging Het
Sez6l2 T A 7: 126,961,886 C448S probably damaging Het
Slc28a3 A T 13: 58,576,793 L216M probably damaging Het
Sorbs1 A G 19: 40,376,989 S117P probably benign Het
Sorl1 A T 9: 42,002,636 C1332* probably null Het
Specc1 T C 11: 62,118,909 V497A probably benign Het
Tmem204 T C 17: 25,058,326 E195G probably damaging Het
Tnfrsf13b T C 11: 61,147,023 probably null Het
Ttll5 G A 12: 86,012,828 V1250M possibly damaging Het
Ube4a G A 9: 44,941,178 T681I probably damaging Het
Ubqln3 C T 7: 104,141,672 V404I probably benign Het
Yeats2 T C 16: 20,211,569 S919P probably benign Het
Zfp575 C T 7: 24,586,722 G3D probably benign Het
Zfp644 C T 5: 106,618,428 silent Het
Other mutations in C87436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:C87436 APN 6 86457855 missense probably damaging 1.00
IGL01596:C87436 APN 6 86446219 missense probably damaging 1.00
IGL02039:C87436 APN 6 86453695 missense probably benign 0.40
IGL02798:C87436 APN 6 86446202 missense probably benign 0.01
R0008:C87436 UTSW 6 86446283 unclassified probably benign
R0128:C87436 UTSW 6 86469827 missense probably damaging 1.00
R0445:C87436 UTSW 6 86449850 missense possibly damaging 0.77
R0970:C87436 UTSW 6 86447328 missense probably damaging 0.99
R1125:C87436 UTSW 6 86447362 missense probably benign 0.00
R1310:C87436 UTSW 6 86445450 missense possibly damaging 0.78
R1640:C87436 UTSW 6 86446251 missense probably damaging 0.99
R1764:C87436 UTSW 6 86453612 missense possibly damaging 0.92
R2213:C87436 UTSW 6 86445473 missense probably benign 0.04
R2275:C87436 UTSW 6 86445600 missense probably damaging 1.00
R3947:C87436 UTSW 6 86446186 missense probably damaging 1.00
R5604:C87436 UTSW 6 86447355 missense probably benign
R5982:C87436 UTSW 6 86445975 missense possibly damaging 0.87
R6171:C87436 UTSW 6 86445467 missense probably benign 0.04
R6744:C87436 UTSW 6 86446064 missense probably damaging 1.00
R7215:C87436 UTSW 6 86462680 missense possibly damaging 0.80
R7253:C87436 UTSW 6 86465808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCCAAAGAAGCCTGAG -3'
(R):5'- TTTGATGAAGGACCAGACCC -3'

Sequencing Primer
(F):5'- GCAATACCTAGGTGCAGTCATGTC -3'
(R):5'- CAGAGCCTCAGAACGGAGCTC -3'
Posted On2016-09-01