Incidental Mutation 'R5416:Tnfrsf13b'
ID 427746
Institutional Source Beutler Lab
Gene Symbol Tnfrsf13b
Ensembl Gene ENSMUSG00000010142
Gene Name tumor necrosis factor receptor superfamily, member 13b
Synonyms Taci, 1200009E08Rik
MMRRC Submission 042985-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R5416 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 61126755-61149372 bp(+) (GRCm38)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to C at 61147023 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010286] [ENSMUST00000041683] [ENSMUST00000101103] [ENSMUST00000139422] [ENSMUST00000146033]
AlphaFold Q9ET35
Predicted Effect probably null
Transcript: ENSMUST00000010286
SMART Domains Protein: ENSMUSP00000010286
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 79 1.7e-24 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041683
SMART Domains Protein: ENSMUSP00000041263
Gene: ENSMUSG00000042506

DomainStartEndE-ValueType
Pfam:zf-UBP 63 124 5.5e-16 PFAM
Pfam:UCH 175 517 5.5e-60 PFAM
Pfam:UCH_1 176 501 2.8e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101103
SMART Domains Protein: ENSMUSP00000098662
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 81 2.6e-33 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137832
Predicted Effect probably benign
Transcript: ENSMUST00000139422
SMART Domains Protein: ENSMUSP00000116175
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 1.03e-5 PROSPERO
Pfam:TACI-CRD2 41 81 9.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146033
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lymphocyte-specific member of the tumor necrosis factor (TNF) receptor superfamily. It interacts with calcium-modulator and cyclophilin ligand (CAML). The protein induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show increased B cell numbers and splenomegaly. Homozygotes for a null allele show impaired T cell-independent immune responses and isotype switching. Homozygotes for another null allele develop lymphoproliferation and fatal autoimmune nephritis with high titers of autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,907,596 E689D probably damaging Het
Acsl6 A G 11: 54,337,171 E339G probably benign Het
Adcy3 G A 12: 4,209,308 E861K probably damaging Het
Adrm1 C T 2: 180,176,137 T394I probably benign Het
Adsl T A 15: 80,952,183 probably null Het
Asxl3 T A 18: 22,524,494 C1854S probably damaging Het
C87436 A G 6: 86,465,850 Y458C probably damaging Het
Cacna1e T C 1: 154,465,779 D1161G probably damaging Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cdh18 A G 15: 23,226,723 Y90C probably damaging Het
Chadl T C 15: 81,693,899 R510G probably benign Het
Clcnkb T C 4: 141,413,900 T115A probably benign Het
Clptm1 C A 7: 19,633,816 probably benign Het
Col24a1 A T 3: 145,315,025 R386* probably null Het
Ctsj G T 13: 61,004,523 L10M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx40 T C 11: 86,797,691 D302G probably benign Het
Edrf1 T C 7: 133,641,402 F166L possibly damaging Het
Epha1 A T 6: 42,365,871 M248K probably damaging Het
Evpl C A 11: 116,234,259 V126L probably benign Het
Fam83d T C 2: 158,785,632 C414R possibly damaging Het
Fat2 T C 11: 55,303,688 N1175S possibly damaging Het
Fhad1 G A 4: 141,918,802 T283I probably benign Het
Fuca1 A G 4: 135,922,980 T121A probably damaging Het
Gm13941 A T 2: 111,094,734 S175T unknown Het
Gpr107 T A 2: 31,185,548 I357N probably damaging Het
Gpr161 T A 1: 165,321,461 H466Q probably benign Het
Hsd3b5 A G 3: 98,619,150 F327L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Itgb7 A T 15: 102,217,309 D628E probably benign Het
Nwd1 A G 8: 72,666,694 D236G possibly damaging Het
Olfr214 A T 6: 116,557,205 Y260F probably damaging Het
Olfr663 C T 7: 104,703,716 L50F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 A G 18: 37,356,955 Y562C probably damaging Het
Phkg2 A G 7: 127,582,935 H376R possibly damaging Het
Plxnc1 G A 10: 94,837,554 T1018I probably damaging Het
Ppp6r1 A T 7: 4,639,748 D532E possibly damaging Het
Prkdc T C 16: 15,805,950 L3259P probably damaging Het
Prkg2 A T 5: 98,943,467 D641E probably benign Het
Psg26 T C 7: 18,482,600 T105A probably benign Het
Ptprs T C 17: 56,435,724 T473A probably damaging Het
Pwp2 G T 10: 78,183,001 N57K probably damaging Het
Rnf216 G T 5: 143,015,771 C733* probably null Het
Serpina1f T A 12: 103,693,944 K26N possibly damaging Het
Sez6l2 T A 7: 126,961,886 C448S probably damaging Het
Slc28a3 A T 13: 58,576,793 L216M probably damaging Het
Sorbs1 A G 19: 40,376,989 S117P probably benign Het
Sorl1 A T 9: 42,002,636 C1332* probably null Het
Specc1 T C 11: 62,118,909 V497A probably benign Het
Tmem204 T C 17: 25,058,326 E195G probably damaging Het
Ttll5 G A 12: 86,012,828 V1250M possibly damaging Het
Ube4a G A 9: 44,941,178 T681I probably damaging Het
Ubqln3 C T 7: 104,141,672 V404I probably benign Het
Yeats2 T C 16: 20,211,569 S919P probably benign Het
Zfp575 C T 7: 24,586,722 G3D probably benign Het
Zfp644 C T 5: 106,618,428 silent Het
Other mutations in Tnfrsf13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Tnfrsf13b APN 11 61141320 missense possibly damaging 0.51
R0523:Tnfrsf13b UTSW 11 61147587 missense probably benign 0.33
R2297:Tnfrsf13b UTSW 11 61147445 missense probably benign
R2517:Tnfrsf13b UTSW 11 61141476 missense probably benign 0.27
R4298:Tnfrsf13b UTSW 11 61140817 splice site probably null
R4299:Tnfrsf13b UTSW 11 61140817 splice site probably null
R4454:Tnfrsf13b UTSW 11 61141438 missense probably benign 0.33
R4931:Tnfrsf13b UTSW 11 61140937 missense possibly damaging 0.66
R7995:Tnfrsf13b UTSW 11 61140916 nonsense probably null
R8531:Tnfrsf13b UTSW 11 61140951 critical splice donor site probably null
R8790:Tnfrsf13b UTSW 11 61147524 missense possibly damaging 0.53
R8858:Tnfrsf13b UTSW 11 61147537 missense possibly damaging 0.73
RF013:Tnfrsf13b UTSW 11 61141444 missense probably benign
Z1176:Tnfrsf13b UTSW 11 61147010 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ACCCACAGGATTGAGGCTAAG -3'
(R):5'- CGATCTCCTCTCAAAGCTGAAG -3'

Sequencing Primer
(F):5'- TGACTCTCTACTGCACAC -3'
(R):5'- TCTCAAAGCTGAAGCAAGAACCTG -3'
Posted On 2016-09-01