Incidental Mutation 'R5416:Specc1'
ID427747
Institutional Source Beutler Lab
Gene Symbol Specc1
Ensembl Gene ENSMUSG00000042331
Gene Namesperm antigen with calponin homology and coiled-coil domains 1
SynonymsCytsb
MMRRC Submission 042985-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5416 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61956763-62223013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62118909 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 497 (V497A)
Ref Sequence ENSEMBL: ENSMUSP00000144161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049836] [ENSMUST00000092415] [ENSMUST00000108709] [ENSMUST00000201015] [ENSMUST00000201364] [ENSMUST00000201624] [ENSMUST00000201671] [ENSMUST00000201723] [ENSMUST00000202178] [ENSMUST00000202179] [ENSMUST00000202389] [ENSMUST00000202744] [ENSMUST00000202905]
Predicted Effect probably benign
Transcript: ENSMUST00000049836
AA Change: V497A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063102
Gene: ENSMUSG00000042331
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092415
AA Change: V417A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331
AA Change: V417A

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 832 844 N/A INTRINSIC
CH 883 981 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108709
AA Change: V497A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201015
SMART Domains Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
CH 303 401 1.4e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201364
AA Change: V497A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
CH 954 1052 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201624
AA Change: V497A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144659
Gene: ENSMUSG00000042331
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201671
AA Change: V497A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144030
Gene: ENSMUSG00000042331
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201723
AA Change: V417A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000144542
Gene: ENSMUSG00000042331
AA Change: V417A

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201866
Predicted Effect probably benign
Transcript: ENSMUST00000202178
AA Change: V497A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000144161
Gene: ENSMUSG00000042331
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202179
AA Change: V417A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331
AA Change: V417A

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
CH 874 972 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202389
AA Change: V497A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202744
SMART Domains Protein: ENSMUSP00000144483
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202905
AA Change: V497A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,907,596 E689D probably damaging Het
Acsl6 A G 11: 54,337,171 E339G probably benign Het
Adcy3 G A 12: 4,209,308 E861K probably damaging Het
Adrm1 C T 2: 180,176,137 T394I probably benign Het
Adsl T A 15: 80,952,183 probably null Het
Asxl3 T A 18: 22,524,494 C1854S probably damaging Het
C87436 A G 6: 86,465,850 Y458C probably damaging Het
Cacna1e T C 1: 154,465,779 D1161G probably damaging Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cdh18 A G 15: 23,226,723 Y90C probably damaging Het
Chadl T C 15: 81,693,899 R510G probably benign Het
Clcnkb T C 4: 141,413,900 T115A probably benign Het
Clptm1 C A 7: 19,633,816 probably benign Het
Col24a1 A T 3: 145,315,025 R386* probably null Het
Ctsj G T 13: 61,004,523 L10M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx40 T C 11: 86,797,691 D302G probably benign Het
Edrf1 T C 7: 133,641,402 F166L possibly damaging Het
Epha1 A T 6: 42,365,871 M248K probably damaging Het
Evpl C A 11: 116,234,259 V126L probably benign Het
Fam83d T C 2: 158,785,632 C414R possibly damaging Het
Fat2 T C 11: 55,303,688 N1175S possibly damaging Het
Fhad1 G A 4: 141,918,802 T283I probably benign Het
Fuca1 A G 4: 135,922,980 T121A probably damaging Het
Gm13941 A T 2: 111,094,734 S175T unknown Het
Gpr107 T A 2: 31,185,548 I357N probably damaging Het
Gpr161 T A 1: 165,321,461 H466Q probably benign Het
Hsd3b5 A G 3: 98,619,150 F327L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Itgb7 A T 15: 102,217,309 D628E probably benign Het
Nwd1 A G 8: 72,666,694 D236G possibly damaging Het
Olfr214 A T 6: 116,557,205 Y260F probably damaging Het
Olfr663 C T 7: 104,703,716 L50F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 A G 18: 37,356,955 Y562C probably damaging Het
Phkg2 A G 7: 127,582,935 H376R possibly damaging Het
Plxnc1 G A 10: 94,837,554 T1018I probably damaging Het
Ppp6r1 A T 7: 4,639,748 D532E possibly damaging Het
Prkdc T C 16: 15,805,950 L3259P probably damaging Het
Prkg2 A T 5: 98,943,467 D641E probably benign Het
Psg26 T C 7: 18,482,600 T105A probably benign Het
Ptprs T C 17: 56,435,724 T473A probably damaging Het
Pwp2 G T 10: 78,183,001 N57K probably damaging Het
Rnf216 G T 5: 143,015,771 C733* probably null Het
Serpina1f T A 12: 103,693,944 K26N possibly damaging Het
Sez6l2 T A 7: 126,961,886 C448S probably damaging Het
Slc28a3 A T 13: 58,576,793 L216M probably damaging Het
Sorbs1 A G 19: 40,376,989 S117P probably benign Het
Sorl1 A T 9: 42,002,636 C1332* probably null Het
Tmem204 T C 17: 25,058,326 E195G probably damaging Het
Tnfrsf13b T C 11: 61,147,023 probably null Het
Ttll5 G A 12: 86,012,828 V1250M possibly damaging Het
Ube4a G A 9: 44,941,178 T681I probably damaging Het
Ubqln3 C T 7: 104,141,672 V404I probably benign Het
Yeats2 T C 16: 20,211,569 S919P probably benign Het
Zfp575 C T 7: 24,586,722 G3D probably benign Het
Zfp644 C T 5: 106,618,428 silent Het
Other mutations in Specc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Specc1 APN 11 62118009 missense probably benign 0.02
IGL01953:Specc1 APN 11 62118296 missense probably benign 0.40
IGL02244:Specc1 APN 11 62128368 missense probably benign 0.41
IGL02257:Specc1 APN 11 62118417 missense probably damaging 1.00
IGL02512:Specc1 APN 11 62118389 missense probably damaging 1.00
IGL03147:Specc1 UTSW 11 62118282 missense probably benign
R0039:Specc1 UTSW 11 62029369 missense probably damaging 0.97
R0114:Specc1 UTSW 11 62146313 missense possibly damaging 0.92
R0635:Specc1 UTSW 11 62118903 missense probably damaging 1.00
R1514:Specc1 UTSW 11 62156532 missense probably damaging 1.00
R1604:Specc1 UTSW 11 62043057 missense probably damaging 1.00
R1717:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1719:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1739:Specc1 UTSW 11 62118818 nonsense probably null
R1757:Specc1 UTSW 11 62119284 critical splice donor site probably null
R1990:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R1991:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R2063:Specc1 UTSW 11 62118296 missense probably benign 0.01
R2071:Specc1 UTSW 11 62117875 missense probably damaging 0.98
R2245:Specc1 UTSW 11 62131887 missense probably damaging 1.00
R3415:Specc1 UTSW 11 62118419 missense probably benign 0.29
R3831:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R3890:Specc1 UTSW 11 62151913 missense probably benign 0.00
R3891:Specc1 UTSW 11 62151913 missense probably benign 0.00
R4367:Specc1 UTSW 11 62118530 missense probably damaging 1.00
R4489:Specc1 UTSW 11 62151827 splice site probably null
R4580:Specc1 UTSW 11 62219331 missense probably damaging 1.00
R4852:Specc1 UTSW 11 62211684 missense probably damaging 1.00
R4930:Specc1 UTSW 11 62118958 missense possibly damaging 0.93
R5016:Specc1 UTSW 11 62118957 missense possibly damaging 0.92
R5650:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R6158:Specc1 UTSW 11 62118124 missense probably damaging 0.99
R6329:Specc1 UTSW 11 62156553 missense probably damaging 1.00
R6374:Specc1 UTSW 11 62156592 missense possibly damaging 0.93
R6395:Specc1 UTSW 11 62132338 missense probably damaging 1.00
R6653:Specc1 UTSW 11 62146418 missense probably damaging 0.99
R6893:Specc1 UTSW 11 62132453 missense probably benign
R6898:Specc1 UTSW 11 62118336 missense probably benign
R7054:Specc1 UTSW 11 62117778 missense probably damaging 0.96
R7294:Specc1 UTSW 11 62118337 missense probably benign 0.01
R7376:Specc1 UTSW 11 62118252 missense probably benign 0.06
R7560:Specc1 UTSW 11 62128409 critical splice donor site probably null
R7605:Specc1 UTSW 11 62211680 missense possibly damaging 0.91
R7621:Specc1 UTSW 11 62128384 missense possibly damaging 0.96
R7804:Specc1 UTSW 11 62205397 missense probably damaging 0.99
R7900:Specc1 UTSW 11 62219361 missense probably damaging 1.00
R8310:Specc1 UTSW 11 62132345 missense probably damaging 1.00
R8319:Specc1 UTSW 11 62118675 missense possibly damaging 0.77
Z1177:Specc1 UTSW 11 62118767 missense possibly damaging 0.86
Z1177:Specc1 UTSW 11 62205423 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AGAAGACCATTCTGGAGACCTC -3'
(R):5'- GCCTTCAAGGACCCATTCTC -3'

Sequencing Primer
(F):5'- GGAGACCTCCTTCCACCAG -3'
(R):5'- AAGGACCCATTCTCCATTTTCAAG -3'
Posted On2016-09-01