Incidental Mutation 'R5416:Serpina1f'
ID 427752
Institutional Source Beutler Lab
Gene Symbol Serpina1f
Ensembl Gene ENSMUSG00000021081
Gene Name serine (or cysteine) peptidase inhibitor, clade A, member 1F
Synonyms epserin, 0610012A11Rik
MMRRC Submission 042985-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5416 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 103688044-103695529 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103693944 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 26 (K26N)
Ref Sequence ENSEMBL: ENSMUSP00000113736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021490] [ENSMUST00000117053] [ENSMUST00000118101]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000021490
AA Change: K26N

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021490
Gene: ENSMUSG00000021081
AA Change: K26N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 409 7.69e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117053
AA Change: K26N

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112533
Gene: ENSMUSG00000021081
AA Change: K26N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 354 1.23e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118101
AA Change: K26N

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113736
Gene: ENSMUSG00000021081
AA Change: K26N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 409 7.69e-85 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,907,596 E689D probably damaging Het
Acsl6 A G 11: 54,337,171 E339G probably benign Het
Adcy3 G A 12: 4,209,308 E861K probably damaging Het
Adrm1 C T 2: 180,176,137 T394I probably benign Het
Adsl T A 15: 80,952,183 probably null Het
Asxl3 T A 18: 22,524,494 C1854S probably damaging Het
C87436 A G 6: 86,465,850 Y458C probably damaging Het
Cacna1e T C 1: 154,465,779 D1161G probably damaging Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cdh18 A G 15: 23,226,723 Y90C probably damaging Het
Chadl T C 15: 81,693,899 R510G probably benign Het
Clcnkb T C 4: 141,413,900 T115A probably benign Het
Clptm1 C A 7: 19,633,816 probably benign Het
Col24a1 A T 3: 145,315,025 R386* probably null Het
Ctsj G T 13: 61,004,523 L10M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx40 T C 11: 86,797,691 D302G probably benign Het
Edrf1 T C 7: 133,641,402 F166L possibly damaging Het
Epha1 A T 6: 42,365,871 M248K probably damaging Het
Evpl C A 11: 116,234,259 V126L probably benign Het
Fam83d T C 2: 158,785,632 C414R possibly damaging Het
Fat2 T C 11: 55,303,688 N1175S possibly damaging Het
Fhad1 G A 4: 141,918,802 T283I probably benign Het
Fuca1 A G 4: 135,922,980 T121A probably damaging Het
Gm13941 A T 2: 111,094,734 S175T unknown Het
Gpr107 T A 2: 31,185,548 I357N probably damaging Het
Gpr161 T A 1: 165,321,461 H466Q probably benign Het
Hsd3b5 A G 3: 98,619,150 F327L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Itgb7 A T 15: 102,217,309 D628E probably benign Het
Nwd1 A G 8: 72,666,694 D236G possibly damaging Het
Olfr214 A T 6: 116,557,205 Y260F probably damaging Het
Olfr663 C T 7: 104,703,716 L50F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 A G 18: 37,356,955 Y562C probably damaging Het
Phkg2 A G 7: 127,582,935 H376R possibly damaging Het
Plxnc1 G A 10: 94,837,554 T1018I probably damaging Het
Ppp6r1 A T 7: 4,639,748 D532E possibly damaging Het
Prkdc T C 16: 15,805,950 L3259P probably damaging Het
Prkg2 A T 5: 98,943,467 D641E probably benign Het
Psg26 T C 7: 18,482,600 T105A probably benign Het
Ptprs T C 17: 56,435,724 T473A probably damaging Het
Pwp2 G T 10: 78,183,001 N57K probably damaging Het
Rnf216 G T 5: 143,015,771 C733* probably null Het
Sez6l2 T A 7: 126,961,886 C448S probably damaging Het
Slc28a3 A T 13: 58,576,793 L216M probably damaging Het
Sorbs1 A G 19: 40,376,989 S117P probably benign Het
Sorl1 A T 9: 42,002,636 C1332* probably null Het
Specc1 T C 11: 62,118,909 V497A probably benign Het
Tmem204 T C 17: 25,058,326 E195G probably damaging Het
Tnfrsf13b T C 11: 61,147,023 probably null Het
Ttll5 G A 12: 86,012,828 V1250M possibly damaging Het
Ube4a G A 9: 44,941,178 T681I probably damaging Het
Ubqln3 C T 7: 104,141,672 V404I probably benign Het
Yeats2 T C 16: 20,211,569 S919P probably benign Het
Zfp575 C T 7: 24,586,722 G3D probably benign Het
Zfp644 C T 5: 106,618,428 silent Het
Other mutations in Serpina1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Serpina1f APN 12 103691869 missense probably benign 0.02
IGL00757:Serpina1f APN 12 103693462 missense probably damaging 1.00
IGL01123:Serpina1f APN 12 103694006 missense possibly damaging 0.47
IGL01695:Serpina1f APN 12 103693684 missense probably damaging 1.00
IGL01791:Serpina1f APN 12 103693502 missense probably damaging 1.00
IGL01868:Serpina1f APN 12 103693445 missense probably benign 0.24
IGL02135:Serpina1f APN 12 103693715 missense possibly damaging 0.90
IGL03025:Serpina1f APN 12 103693546 missense probably damaging 0.99
IGL03331:Serpina1f APN 12 103690891 missense probably benign 0.04
R0084:Serpina1f UTSW 12 103693588 missense possibly damaging 0.82
R0492:Serpina1f UTSW 12 103693567 missense possibly damaging 0.72
R0893:Serpina1f UTSW 12 103693835 missense probably damaging 0.97
R2202:Serpina1f UTSW 12 103693396 missense possibly damaging 0.75
R3974:Serpina1f UTSW 12 103693571 nonsense probably null
R4179:Serpina1f UTSW 12 103691920 missense probably benign 0.08
R4736:Serpina1f UTSW 12 103693546 missense probably damaging 0.97
R4948:Serpina1f UTSW 12 103689751 missense probably damaging 1.00
R5092:Serpina1f UTSW 12 103693550 missense probably damaging 1.00
R5887:Serpina1f UTSW 12 103689787 missense possibly damaging 0.85
R5887:Serpina1f UTSW 12 103693631 nonsense probably null
R6413:Serpina1f UTSW 12 103693694 missense probably damaging 1.00
R6566:Serpina1f UTSW 12 103693535 missense probably damaging 1.00
R7371:Serpina1f UTSW 12 103689827 missense probably damaging 0.96
R7419:Serpina1f UTSW 12 103689842 missense probably damaging 1.00
R7527:Serpina1f UTSW 12 103691908 missense probably benign 0.16
R7943:Serpina1f UTSW 12 103693690 missense probably damaging 0.98
R8249:Serpina1f UTSW 12 103693768 missense probably damaging 1.00
R8270:Serpina1f UTSW 12 103693498 missense probably damaging 1.00
R8810:Serpina1f UTSW 12 103693981 missense probably benign 0.00
R8962:Serpina1f UTSW 12 103689872 missense probably benign 0.01
R9657:Serpina1f UTSW 12 103689791 nonsense probably null
Z1176:Serpina1f UTSW 12 103691866 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGTTGCCATTGGATCCCAG -3'
(R):5'- AGCTATAGAAAGTGCCGGGC -3'

Sequencing Primer
(F):5'- TTGGATCCCAGGGACAGCATTG -3'
(R):5'- CACAGGAATAGGAAACTGTGGTTGC -3'
Posted On 2016-09-01