Incidental Mutation 'R5416:Abcb5'
ID427753
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms9230106F14Rik
MMRRC Submission 042985-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R5416 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location118867824-118966421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118907596 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 689 (E689D)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
Predicted Effect probably damaging
Transcript: ENSMUST00000035515
AA Change: E689D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: E689D

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100982
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,337,171 E339G probably benign Het
Adcy3 G A 12: 4,209,308 E861K probably damaging Het
Adrm1 C T 2: 180,176,137 T394I probably benign Het
Adsl T A 15: 80,952,183 probably null Het
Asxl3 T A 18: 22,524,494 C1854S probably damaging Het
C87436 A G 6: 86,465,850 Y458C probably damaging Het
Cacna1e T C 1: 154,465,779 D1161G probably damaging Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cdh18 A G 15: 23,226,723 Y90C probably damaging Het
Chadl T C 15: 81,693,899 R510G probably benign Het
Clcnkb T C 4: 141,413,900 T115A probably benign Het
Clptm1 C A 7: 19,633,816 probably benign Het
Col24a1 A T 3: 145,315,025 R386* probably null Het
Ctsj G T 13: 61,004,523 L10M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx40 T C 11: 86,797,691 D302G probably benign Het
Edrf1 T C 7: 133,641,402 F166L possibly damaging Het
Epha1 A T 6: 42,365,871 M248K probably damaging Het
Evpl C A 11: 116,234,259 V126L probably benign Het
Fam83d T C 2: 158,785,632 C414R possibly damaging Het
Fat2 T C 11: 55,303,688 N1175S possibly damaging Het
Fhad1 G A 4: 141,918,802 T283I probably benign Het
Fuca1 A G 4: 135,922,980 T121A probably damaging Het
Gm13941 A T 2: 111,094,734 S175T unknown Het
Gpr107 T A 2: 31,185,548 I357N probably damaging Het
Gpr161 T A 1: 165,321,461 H466Q probably benign Het
Hsd3b5 A G 3: 98,619,150 F327L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Itgb7 A T 15: 102,217,309 D628E probably benign Het
Nwd1 A G 8: 72,666,694 D236G possibly damaging Het
Olfr214 A T 6: 116,557,205 Y260F probably damaging Het
Olfr663 C T 7: 104,703,716 L50F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 A G 18: 37,356,955 Y562C probably damaging Het
Phkg2 A G 7: 127,582,935 H376R possibly damaging Het
Plxnc1 G A 10: 94,837,554 T1018I probably damaging Het
Ppp6r1 A T 7: 4,639,748 D532E possibly damaging Het
Prkdc T C 16: 15,805,950 L3259P probably damaging Het
Prkg2 A T 5: 98,943,467 D641E probably benign Het
Psg26 T C 7: 18,482,600 T105A probably benign Het
Ptprs T C 17: 56,435,724 T473A probably damaging Het
Pwp2 G T 10: 78,183,001 N57K probably damaging Het
Rnf216 G T 5: 143,015,771 C733* probably null Het
Serpina1f T A 12: 103,693,944 K26N possibly damaging Het
Sez6l2 T A 7: 126,961,886 C448S probably damaging Het
Slc28a3 A T 13: 58,576,793 L216M probably damaging Het
Sorbs1 A G 19: 40,376,989 S117P probably benign Het
Sorl1 A T 9: 42,002,636 C1332* probably null Het
Specc1 T C 11: 62,118,909 V497A probably benign Het
Tmem204 T C 17: 25,058,326 E195G probably damaging Het
Tnfrsf13b T C 11: 61,147,023 probably null Het
Ttll5 G A 12: 86,012,828 V1250M possibly damaging Het
Ube4a G A 9: 44,941,178 T681I probably damaging Het
Ubqln3 C T 7: 104,141,672 V404I probably benign Het
Yeats2 T C 16: 20,211,569 S919P probably benign Het
Zfp575 C T 7: 24,586,722 G3D probably benign Het
Zfp644 C T 5: 106,618,428 silent Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118936098 missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118890687 missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118931925 missense probably benign 0.00
R7061:Abcb5 UTSW 12 118877774 missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118867876 missense probably benign 0.00
R7239:Abcb5 UTSW 12 118928725 missense probably benign 0.19
R7267:Abcb5 UTSW 12 118952470 missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118911560 missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118867874 missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118918164 missense probably damaging 1.00
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118918272 missense not run
Predicted Primers PCR Primer
(F):5'- GAAAGTTCTGGTTCCCATTGTG -3'
(R):5'- GACTCATCGTTAGTAATAACAGTGG -3'

Sequencing Primer
(F):5'- GCTGATCAATACAATACAGCTCTGTG -3'
(R):5'- TCCAGTGCACTTCCGTAT -3'
Posted On2016-09-01