Incidental Mutation 'R5417:Dolpp1'
ID427774
Institutional Source Beutler Lab
Gene Symbol Dolpp1
Ensembl Gene ENSMUSG00000026856
Gene Namedolichyl pyrophosphate phosphatase 1
Synonyms0610011H20Rik, LSFR2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30392254-30400529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30396237 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 18 (L18P)
Ref Sequence ENSEMBL: ENSMUSP00000119478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028207] [ENSMUST00000028209] [ENSMUST00000102855] [ENSMUST00000113612] [ENSMUST00000123202]
Predicted Effect probably benign
Transcript: ENSMUST00000028207
SMART Domains Protein: ENSMUSP00000028207
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 616 1.9e-235 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000028209
AA Change: L116P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028209
Gene: ENSMUSG00000026856
AA Change: L116P

DomainStartEndE-ValueType
acidPPc 59 180 1.31e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102855
SMART Domains Protein: ENSMUSP00000099919
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 35 615 2.4e-195 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113612
AA Change: L116P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109242
Gene: ENSMUSG00000026856
AA Change: L116P

DomainStartEndE-ValueType
Pfam:PAP2 58 165 1.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123202
AA Change: L18P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119478
Gene: ENSMUSG00000026856
AA Change: L18P

DomainStartEndE-ValueType
Pfam:PAP2 1 90 8.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133991
Predicted Effect unknown
Transcript: ENSMUST00000137248
AA Change: S87P
SMART Domains Protein: ENSMUSP00000116276
Gene: ENSMUSG00000026856
AA Change: S87P

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
low complexity region 71 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152303
Predicted Effect unknown
Transcript: ENSMUST00000155196
AA Change: S85P
SMART Domains Protein: ENSMUSP00000115602
Gene: ENSMUSG00000026856
AA Change: S85P

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
low complexity region 69 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156984
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A similar gene has been characterized in mice and encodes dolichyl pyrophosphate (Dol-P-P) phosphatase. This protein dephosphorylates dolichyl pyrophosphate so that it may be re-utilized as a glycosyl carrier lipid by the oligosaccharyltransferase multisubunit complex in the ER. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Dolpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Dolpp1 APN 2 30397095 missense probably damaging 1.00
IGL02896:Dolpp1 APN 2 30396230 missense probably damaging 0.99
R1321:Dolpp1 UTSW 2 30395736 missense possibly damaging 0.83
R2032:Dolpp1 UTSW 2 30392441 missense probably damaging 1.00
R3722:Dolpp1 UTSW 2 30397488 missense probably damaging 0.98
R4407:Dolpp1 UTSW 2 30396452 missense possibly damaging 0.91
R5895:Dolpp1 UTSW 2 30395646 splice site probably benign
R6270:Dolpp1 UTSW 2 30392269 unclassified probably benign
R7818:Dolpp1 UTSW 2 30396491 missense probably benign 0.24
R8108:Dolpp1 UTSW 2 30396246 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCAAACACGTCATCCAGGAG -3'
(R):5'- GCATTCTGGGAAAAGAGGCC -3'

Sequencing Primer
(F):5'- ACGTCATCCAGGAGCCTCG -3'
(R):5'- GAGGCCCATCAGACAGCCTC -3'
Posted On2016-09-01