Incidental Mutation 'R5417:Nr5a1'
ID427775
Institutional Source Beutler Lab
Gene Symbol Nr5a1
Ensembl Gene ENSMUSG00000026751
Gene Namenuclear receptor subfamily 5, group A, member 1
SynonymsELP, Ad4BP, SF1, Ftzf1, SF-1, steroidogenic factor 1, adrenal 4-binding protein, Ftz-F1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5417 (G1)
Quality Score202
Status Not validated
Chromosome2
Chromosomal Location38692656-38714542 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38708086 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 233 (Q233L)
Ref Sequence ENSEMBL: ENSMUSP00000108504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028084] [ENSMUST00000112883]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028084
AA Change: Q233L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028084
Gene: ENSMUSG00000026751
AA Change: Q233L

DomainStartEndE-ValueType
ZnF_C4 10 81 2.41e-38 SMART
low complexity region 124 142 N/A INTRINSIC
low complexity region 195 222 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
HOLI 268 431 3.54e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112883
AA Change: Q233L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108504
Gene: ENSMUSG00000026751
AA Change: Q233L

DomainStartEndE-ValueType
ZnF_C4 10 81 2.41e-38 SMART
low complexity region 124 142 N/A INTRINSIC
low complexity region 195 222 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
HOLI 268 431 3.54e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149690
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator involved in sex determination. The encoded protein binds DNA as a monomer. Defects in this gene are a cause of XY sex reversal with or without adrenal failure as well as adrenocortical insufficiency without ovarian defect. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit agenesis of the adrenal glands and gonads, defects of the ventromedial hypothalamic nucleus, impaired pituitary gonadotroph function, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Nr5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nr5a1 APN 2 38708341 missense probably benign 0.00
IGL02869:Nr5a1 APN 2 38708129 missense probably benign
IGL03081:Nr5a1 APN 2 38710532 missense possibly damaging 0.92
R0053:Nr5a1 UTSW 2 38694166 missense probably damaging 0.98
R1437:Nr5a1 UTSW 2 38710673 missense probably benign
R1753:Nr5a1 UTSW 2 38708419 missense possibly damaging 0.84
R1921:Nr5a1 UTSW 2 38694096 missense probably damaging 1.00
R3500:Nr5a1 UTSW 2 38707940 nonsense probably null
R4393:Nr5a1 UTSW 2 38694219 missense probably damaging 1.00
R5821:Nr5a1 UTSW 2 38708499 missense probably damaging 0.96
R5936:Nr5a1 UTSW 2 38701778 intron probably benign
R6088:Nr5a1 UTSW 2 38701995 missense probably benign
R6443:Nr5a1 UTSW 2 38710430 missense probably damaging 0.99
R7099:Nr5a1 UTSW 2 38694136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGTAGCTAGAGCCAGGGAC -3'
(R):5'- ATCTCTACCCATGGCTGTGC -3'

Sequencing Primer
(F):5'- GGTACCCACCTCCAGCTC -3'
(R):5'- CTGTGCCTGGTCCCCAC -3'
Posted On2016-09-01