Incidental Mutation 'R5417:Gm14443'
ID427780
Institutional Source Beutler Lab
Gene Symbol Gm14443
Ensembl Gene ENSMUSG00000078902
Gene Namepredicted gene 14443
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location175166255-175175871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 175170003 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 217 (C217S)
Ref Sequence ENSEMBL: ENSMUSP00000104682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109054]
Predicted Effect probably damaging
Transcript: ENSMUST00000109054
AA Change: C217S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104682
Gene: ENSMUSG00000078902
AA Change: C217S

DomainStartEndE-ValueType
KRAB 4 66 1.9e-15 SMART
ZnF_C2H2 78 97 1.38e2 SMART
ZnF_C2H2 103 123 3.05e1 SMART
ZnF_C2H2 131 153 1.25e-1 SMART
ZnF_C2H2 159 179 7.89e0 SMART
ZnF_C2H2 187 209 2.27e-4 SMART
ZnF_C2H2 215 237 4.54e-4 SMART
ZnF_C2H2 243 265 5.99e-4 SMART
ZnF_C2H2 271 293 4.54e-4 SMART
ZnF_C2H2 299 321 5.21e-4 SMART
ZnF_C2H2 327 349 3.95e-4 SMART
ZnF_C2H2 355 377 4.24e-4 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 411 433 5.21e-4 SMART
ZnF_C2H2 439 461 3.95e-4 SMART
ZnF_C2H2 467 489 4.24e-4 SMART
ZnF_C2H2 495 517 5.21e-4 SMART
ZnF_C2H2 523 545 3.95e-4 SMART
ZnF_C2H2 551 573 5.21e-4 SMART
ZnF_C2H2 579 601 2.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127251
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Gm14443
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02248:Gm14443 APN 2 175170314 missense probably benign 0.01
R0081:Gm14443 UTSW 2 175169936 missense probably damaging 1.00
R1312:Gm14443 UTSW 2 175171590 splice site probably benign
R1958:Gm14443 UTSW 2 175169704 missense probably benign 0.31
R4061:Gm14443 UTSW 2 175169609 missense probably benign 0.01
R4089:Gm14443 UTSW 2 175171892 missense probably damaging 1.00
R5306:Gm14443 UTSW 2 175169579 missense possibly damaging 0.63
R5405:Gm14443 UTSW 2 175171851 missense possibly damaging 0.55
R6422:Gm14443 UTSW 2 175170381 nonsense probably null
R7410:Gm14443 UTSW 2 175169276 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATTCATAAGGCTGCTCTCCTG -3'
(R):5'- TGCCAATTGTGTTTGCAGGC -3'

Sequencing Primer
(F):5'- CATAAGGCTGCTCTCCTGTATGTG -3'
(R):5'- TGTACTGCAGTGAAACCCTCTGAG -3'
Posted On2016-09-01