Incidental Mutation 'R5417:Tubgcp5'
ID427784
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Nametubulin, gamma complex associated protein 5
SynonymsB130010C12Rik, GCP5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location55794154-55831677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55825661 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 932 (R932G)
Ref Sequence ENSEMBL: ENSMUSP00000032627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206133] [ENSMUST00000206191]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032627
AA Change: R932G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: R932G

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205311
Predicted Effect possibly damaging
Transcript: ENSMUST00000205796
AA Change: R869G

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000206133
Predicted Effect probably benign
Transcript: ENSMUST00000206191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206789
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55806595 missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55808529 missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55796031 splice site probably benign
IGL01597:Tubgcp5 APN 7 55806832 splice site probably benign
IGL01688:Tubgcp5 APN 7 55815018 missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55799473 missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55806088 missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55818757 missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55806607 nonsense probably null
IGL03105:Tubgcp5 APN 7 55825581 missense probably damaging 1.00
ANU05:Tubgcp5 UTSW 7 55808529 missense possibly damaging 0.83
R0078:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55814978 missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55800684 missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55823567 missense probably benign
R0488:Tubgcp5 UTSW 7 55829338 missense probably damaging 0.96
R0853:Tubgcp5 UTSW 7 55814851 splice site probably benign
R0885:Tubgcp5 UTSW 7 55806055 nonsense probably null
R1483:Tubgcp5 UTSW 7 55825707 critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55808537 missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55815020 missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55799511 missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55830881 missense probably damaging 1.00
R3766:Tubgcp5 UTSW 7 55830866 missense probably damaging 0.98
R4154:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55794185 unclassified probably benign
R4948:Tubgcp5 UTSW 7 55806123 missense probably benign 0.00
R5110:Tubgcp5 UTSW 7 55808637 missense probably damaging 0.96
R5347:Tubgcp5 UTSW 7 55823685 missense probably damaging 1.00
R5574:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55814962 missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55823609 missense probably benign
R6141:Tubgcp5 UTSW 7 55806778 missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55795923 missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55817392 nonsense probably null
R6563:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55823583 missense probably benign
R6596:Tubgcp5 UTSW 7 55806634 missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55794229 missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55805366 missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55829407 missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55800695 nonsense probably null
R7213:Tubgcp5 UTSW 7 55806112 missense probably damaging 0.97
R7284:Tubgcp5 UTSW 7 55823567 missense probably benign
R7600:Tubgcp5 UTSW 7 55808513 missense probably benign
R7813:Tubgcp5 UTSW 7 55800696 missense possibly damaging 0.49
R7920:Tubgcp5 UTSW 7 55816562 missense probably benign 0.00
R7948:Tubgcp5 UTSW 7 55794248 missense probably benign 0.01
R8438:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
R8499:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
Z1088:Tubgcp5 UTSW 7 55815101 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGCACAGACCTAGGGAAG -3'
(R):5'- TGGGGCACACATTTATAACCCC -3'

Sequencing Primer
(F):5'- GGAGGCAGAAACAAGAGGATCCTAG -3'
(R):5'- GGCACACATTTATAACCCCATCTAAC -3'
Posted On2016-09-01