Incidental Mutation 'R5417:Fbxw10'
ID427794
Institutional Source Beutler Lab
Gene Symbol Fbxw10
Ensembl Gene ENSMUSG00000090173
Gene NameF-box and WD-40 domain protein 10
SynonymsSM2SH2, SM25H2, Fbw10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location62847069-62877465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62877164 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 942 (R942Q)
Ref Sequence ENSEMBL: ENSMUSP00000135870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014321] [ENSMUST00000036085] [ENSMUST00000150989] [ENSMUST00000176577] [ENSMUST00000177336]
Predicted Effect probably benign
Transcript: ENSMUST00000014321
SMART Domains Protein: ENSMUSP00000014321
Gene: ENSMUSG00000014177

DomainStartEndE-ValueType
Pfam:DUF846 32 174 9.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036085
AA Change: R947Q

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000046156
Gene: ENSMUSG00000090173
AA Change: R947Q

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 6e-14 BLAST
Blast:WD40 416 453 2e-8 BLAST
WD40 457 496 1.78e-5 SMART
WD40 499 536 5.55e-7 SMART
WD40 539 575 2.84e-4 SMART
WD40 578 615 3.81e-5 SMART
WD40 620 656 6.9e-1 SMART
low complexity region 709 724 N/A INTRINSIC
coiled coil region 964 992 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128698
Predicted Effect probably benign
Transcript: ENSMUST00000150989
AA Change: R937Q

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117872
Gene: ENSMUSG00000090173
AA Change: R937Q

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 1e-13 BLAST
Blast:WD40 406 443 2e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
low complexity region 699 714 N/A INTRINSIC
coiled coil region 954 982 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154176
Predicted Effect possibly damaging
Transcript: ENSMUST00000176577
AA Change: R942Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135870
Gene: ENSMUSG00000090173
AA Change: R942Q

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 6e-14 BLAST
Blast:WD40 406 443 2e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
low complexity region 704 719 N/A INTRINSIC
coiled coil region 959 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177336
SMART Domains Protein: ENSMUSP00000135294
Gene: ENSMUSG00000090173

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 5e-14 BLAST
Blast:WD40 406 443 1e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXW10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Fbxw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Fbxw10 APN 11 62873501 missense probably damaging 1.00
IGL01552:Fbxw10 APN 11 62857684 critical splice acceptor site probably null
IGL01625:Fbxw10 APN 11 62860027 missense probably damaging 1.00
IGL01960:Fbxw10 APN 11 62876756 missense probably damaging 1.00
IGL02457:Fbxw10 APN 11 62874982 missense probably damaging 1.00
IGL02475:Fbxw10 APN 11 62857735 missense possibly damaging 0.94
IGL02864:Fbxw10 APN 11 62873523 missense probably damaging 1.00
R0083:Fbxw10 UTSW 11 62877061 missense probably benign 0.00
R0108:Fbxw10 UTSW 11 62877061 missense probably benign 0.00
R0147:Fbxw10 UTSW 11 62847481 unclassified probably null
R0180:Fbxw10 UTSW 11 62853096 missense probably benign 0.09
R0196:Fbxw10 UTSW 11 62877244 missense probably benign 0.01
R0454:Fbxw10 UTSW 11 62876738 missense possibly damaging 0.53
R0529:Fbxw10 UTSW 11 62859845 missense probably damaging 1.00
R0791:Fbxw10 UTSW 11 62847456 missense probably benign 0.18
R0927:Fbxw10 UTSW 11 62876944 missense probably damaging 0.98
R1026:Fbxw10 UTSW 11 62875171 missense probably benign
R1448:Fbxw10 UTSW 11 62847592 missense possibly damaging 0.74
R1468:Fbxw10 UTSW 11 62862638 missense probably damaging 1.00
R1468:Fbxw10 UTSW 11 62862638 missense probably damaging 1.00
R1689:Fbxw10 UTSW 11 62860036 missense probably damaging 1.00
R1785:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2130:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2132:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2211:Fbxw10 UTSW 11 62867535 missense probably damaging 0.99
R3078:Fbxw10 UTSW 11 62867513 splice site probably benign
R3700:Fbxw10 UTSW 11 62869157 splice site probably null
R3932:Fbxw10 UTSW 11 62869157 splice site probably benign
R4843:Fbxw10 UTSW 11 62847325 missense possibly damaging 0.95
R4869:Fbxw10 UTSW 11 62862731 missense probably damaging 0.98
R4879:Fbxw10 UTSW 11 62847747 missense probably damaging 0.99
R4980:Fbxw10 UTSW 11 62847757 missense possibly damaging 0.94
R5531:Fbxw10 UTSW 11 62862656 missense probably damaging 1.00
R5877:Fbxw10 UTSW 11 62857716 missense probably damaging 1.00
R6028:Fbxw10 UTSW 11 62873519 nonsense probably null
R6616:Fbxw10 UTSW 11 62853024 missense probably benign 0.14
R6870:Fbxw10 UTSW 11 62855367 missense probably damaging 0.99
R6967:Fbxw10 UTSW 11 62847603 missense possibly damaging 0.73
R7409:Fbxw10 UTSW 11 62876780 missense possibly damaging 0.86
R7464:Fbxw10 UTSW 11 62853298 missense probably benign 0.01
R7542:Fbxw10 UTSW 11 62850596 missense probably benign 0.33
R7568:Fbxw10 UTSW 11 62875168 missense probably benign
R7733:Fbxw10 UTSW 11 62873397 missense unknown
R7793:Fbxw10 UTSW 11 62847387 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAAAGTCCTTGCACAGTCCC -3'
(R):5'- GGGAGGCCTTTGATCTTACG -3'

Sequencing Primer
(F):5'- TTGCACAGTCCCAGAGTCCAG -3'
(R):5'- TACGGATCCACGCAGCTTTG -3'
Posted On2016-09-01